CN0219.1 24.8607405200657 LM219 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGYKTTGYYWWRGCAAMRCA" ; medline "17442748" ; species "9606" CN0217.1 23.7427223366843 LM217 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TTTCATTAGAAGATGAAGCA" ; medline "17442748" ; species "9606" CN0076.1 26.6735842900843 LM76 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CCAATTTGCATTTCATTTGC" ; medline "17442748" ; species "9606" PH0154.1 14.9612739285114 Prrx1 Helix-Turn-Helix ; acc "P63013" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0006.1 37.556203116516 LM6 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CAAAGGCTCTTTTMAGAGCCACY" ; medline "17442748" ; species "9606" MA0184.1 10.5810878311503 CG9876 Helix-Turn-Helix ; acc "Q7YU61" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PF0114.1 19.0526468210145 YTCCCRNNAGGY Unknown ; MCS "12.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PH0136.1 14.3629654757121 Phox2b Helix-Turn-Helix ; acc "O35690" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0145.1 24.4465940941895 LM145 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "MTWCTCAGATGAAAGRTGCTW" ; medline "17442748" ; species "9606" PH0061.1 10.6625925113586 Hoxb6 Helix-Turn-Helix ; acc "P09023" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0093.1 11.2902795805709 USF1 Zipper-Type ; acc "P22415" ; collection "CORE" ; comment "-" ; family "Helix-Loop-Helix" ; medline "8052536" ; pazar_tf_id "TF0000067" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" CN0069.1 23.3889916959147 LM69 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WGCTAATTRRMTKYYWAWTANM" ; medline "17442748" ; species "9606" CN0204.1 24.943067891469 LM204 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTYAAATCCTTTYTGGAA" ; medline "17442748" ; species "9606" MA0135.1 16.3541415144804 Lhx3 Helix-Turn-Helix ; acc "P50481" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "11602361" ; pazar_tf_id "TF0000827" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" PF0065.1 17.0077333612805 ARGGGTTAA Unknown ; MCS "18.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "FXR(*)" ; type "phylogenetic" CN0210.1 24.4720016602023 LM210 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TCATYTTGCTTCTGAAAATG" ; medline "17442748" ; species "9606" PH0028.1 13.8265342595288 En1 Helix-Turn-Helix ; acc "P09065" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0364.1 11.5105481084811 REI1 Zinc-coordinating ; acc "YBR267W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" CN0028.1 19.4530351759717 LM28 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "AGAACATCTGTTTCY" ; medline "17442748" ; species "9606" PH0038.1 9.72145300606129 Hlx Helix-Turn-Helix ; acc "Q61670" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0214.1 23.3936017298117 LM214 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TCTGGAAAAGCACATTTGAT" ; medline "17442748" ; species "9606" PH0147.1 13.7538212597244 Pou3f2 Helix-Turn-Helix ; acc "P31360" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0064.1 24 LM64 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGACAGCTGTTT" ; medline "17442748" ; species "9606" MA0107.1 14.7568335646172 RELA Ig-fold ; acc "Q04206" ; collection "CORE" ; comment "-" ; family "Rel Homology Region" ; medline "1406630" ; pazar_tf_id "TF0000078" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" MA0384.1 17.7314545109442 SNT2 Helix-Turn-Helix ; acc "YGL131C" ; collection "CORE" ; family "Myb" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" CN0215.1 23.2712946638551 LM215 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CATTTCTCAGAAATGACT" ; medline "17442748" ; species "9606" CN0043.1 20.1931221351829 LM43 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TTGKCAGRAAATGAWW" ; medline "17442748" ; species "9606" MA0260.1 10.1225649784196 che-1 Zinc-coordinating ; acc "Q966L8" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "17606643" ; species "6239" ; tax_group "nematodes" ; type "COMPILED" PF0093.1 12 GGATTA Unknown ; MCS "14.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "PITX2" ; type "phylogenetic" PF0003.1 14.215601148395 SCGGAAGY Unknown ; MCS "80.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "ELK4" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "ELK-1" ; type "phylogenetic" PF0168.1 14.2775023889509 YTAAYNGCT Unknown ; MCS "9.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PH0052.1 12.3779848562439 Hoxa5 Helix-Turn-Helix ; acc "P09021" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0363.1 13.6375665290057 REB1 Helix-Turn-Helix ; acc "YBR049C" ; collection "CORE" ; family "Myb" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PF0142.1 16.1590132663114 ACAWYAAAG Unknown ; MCS "10.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PH0164.1 13.3437200109299 Six4 Helix-Turn-Helix ; acc "Q61321" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0092.1 10.1435823386149 Hand1::Tcfe2a Zipper-Type ; acc "Q64279,P15806" ; collection "CORE" ; comment "-" ; family "Helix-Loop-Helix" ; medline "7791788" ; pazar_tf_id "TF0000066" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" MA0069.1 13.7977195202109 Pax6 Helix-Turn-Helix ; acc "P26367" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "8132558" ; pazar_tf_id "TF0000045" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" PF0089.1 17.2628290239644 GTTNYYNNGGTNA Unknown ; MCS "14.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PF0034.1 16.8133306424575 CYTAGCAAY Unknown ; MCS "26.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0373.1 11.7282809534733 RPN4 Zinc-coordinating ; acc "YDL020C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PF0136.1 14.2994433643608 TAAYNRNNTCC Unknown ; MCS "11.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PH0150.1 15.0411514730562 Pou4f3 Helix-Turn-Helix ; acc "P63955" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0010.1 16.25583700188 GCCATNTTG Unknown ; MCS "54.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "YY1" ; type "phylogenetic" MA0190.1 10.7593294683233 Gsc Helix-Turn-Helix ; acc "P54366" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" CN0135.1 25.2610814423723 LM135 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "ACCCTRGTGGCCTGAAAGAG" ; medline "17442748" ; species "9606" PB0069.1 10.7463021274099 Sox30 Other Alpha-Helix ; acc "Q8CGW4" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box)" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0042.1 14.3903995929035 Hmx2 Helix-Turn-Helix ; acc "P43687" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0062.1 11.5212191776261 Sox13 Other Alpha-Helix ; acc "Q04891" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0144.1 14.5845040380284 Pou2f2 Helix-Turn-Helix ; acc "Q00196" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0235.1 11.5288165079441 onecut Helix-Turn-Helix ; acc "Q9NJB5" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0375.1 10.0563845774726 RSC30 Zinc-coordinating ; acc "YHR056C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PH0079.1 11.5984025624189 Hoxd3 Helix-Turn-Helix ; acc "P09027" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0125.1 24.0240531513715 LM125 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GCTAATTRCAAATSA" ; medline "17442748" ; species "9606" MA0244.1 8.18009882562683 slbo Zinc-coordinating ; acc "Q02637" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "15572468" ; species "7227" ; tax_group "insects" ; type "DNaseI footprinting" MA0216.1 8.85310453247852 cad Helix-Turn-Helix ; acc "P09085" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0407.1 21.6304825814125 THI2 Zinc-coordinating ; acc "YBR240C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" MA0144.1 13.6006725893023 Stat3 Ig-fold ; acc "P42227" ; collection "CORE" ; comment "-" ; family "Stat Protein" ; medline "18555785 " ; pazar_tf_id "TF0000492" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" PF0056.1 14.4281531120845 GGGTGGRR Unknown ; MCS "20.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "PAX-4" ; type "phylogenetic" MA0370.1 9.90037292689634 RME1 Zinc-coordinating ; acc "YGR044C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" MA0404.1 9.83381455420407 TBS1 Zinc-coordinating ; acc "YBR150C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PH0021.1 11.5011973263549 Dlx2 Helix-Turn-Helix ; acc "P40764" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0054.1 16.4877864484419 TAAWWATAG Unknown ; MCS "21.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "RSRFC4" ; type "phylogenetic" PF0060.1 12 TTGTTT Unknown ; MCS "19.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "FOXF2" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "FOXO4" ; type "phylogenetic" PH0099.1 12.9428653716421 Lhx9 Helix-Turn-Helix ; acc "Q9WUH2" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0337.1 9.14421097975959 MIG1 Zinc-coordinating ; acc "YGL035C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0086.1 10.7055726786483 sna Zinc-coordinating ; acc "P08044" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "8371971" ; pazar_tf_id "TF0000061" ; species "7227" ; tax_group "insects" ; type "SELEX" PH0081.1 12.1988830956743 Pdx1 Helix-Turn-Helix ; acc "P52946" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0064.1 10.6221901518379 Sox15 Other Alpha-Helix ; acc "P43267" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0424.1 9.24952409497998 YER184C Zinc-coordinating ; acc "YER184C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0397.1 11.6860308813466 STP4 Zinc-coordinating ; acc "YDL048C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PF0048.1 17.335559283646 GCGNNANTTCC Unknown ; MCS "22.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "C-REL(*)" ; type "phylogenetic" PF0090.1 15.6763883525985 YAATNRNNNYNATT Unknown ; MCS "14.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "CART-1(*)" ; type "phylogenetic" MA0171.1 10.8915694711545 CG11085 Helix-Turn-Helix ; acc "Q9VYL0" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" CN0137.1 23.4214435483514 LM137 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WNRRAGBAATTTGGCAGCW" ; medline "17442748" ; species "9606" CN0131.1 27.4002809055401 LM131 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TCCAAYTTGGATAATTGCAT" ; medline "17442748" ; species "9606" MA0149.1 32.8714828380974 EWSR1-FLI1 Winged Helix-Turn-Helix ; acc "Q9BZD1" ; collection "CORE" ; comment "fusion protein between EWSR1 and FLI1 in an oncogenic event." ; family "Ets" ; medline "19305498" ; pazar_tf_id "TF0000660" ; species "9606" ; tax_group "vertebrates" ; type "ChiP-seq" MA0294.1 11.1985903414279 EDS1 Zinc-coordinating ; acc "YBR033W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0288.1 10.8309268827297 CUP9 Helix-Turn-Helix ; acc "YPL177C" ; collection "CORE" ; family "Homeo" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PH0167.1 11.4884204897329 Tcf1 Helix-Turn-Helix ; acc "Q66JY7" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0172.1 11.5176777923711 Tlx2 Helix-Turn-Helix ; acc "Q61663" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0248.1 9.38705335288453 tup Helix-Turn-Helix ; acc "Q9VJ37" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PL0013.1 12.0736403311657 hlh-2::hlh-15 Zipper-type ; acc "Q17588,Q18590" ; collection "PBM_HLH" ; comment "heterodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" PH0006.1 15.5011632450799 Barhl2 Helix-Turn-Helix ; acc "Q8VIB5" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0062.2 13.3349242365611 GABPA Winged Helix-Turn-Helix ; acc "Q91YY8" ; collection "CORE" ; comment "-" ; family "Ets" ; medline "19160518 " ; pazar_tf_id "TF0000039" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" PF0119.1 16.7523948696153 GGGNRMNNYCAT Unknown ; MCS "11.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0406.1 10.7605806772712 TEC1 Helix-Turn-Helix ; acc "YBR083W" ; collection "CORE" ; family "Homeo" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0323.1 20.6227955935036 IXR1 Other Alpha-Helix ; acc "YKL032C" ; collection "CORE" ; family "High Mobility Group (Box)" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" MA0382.1 14.5714790885251 SKO1 Zipper-Type ; acc "YNL167C" ; collection "CORE" ; family "Leucine Zipper" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" MA0079.2 11.1288626921664 SP1 Zinc-coordinating ; acc "P08047" ; collection "CORE" ; comment "Annotations from PAZAR SP1 + SP1_MOUSE + SP1_HUMAN + SP1_RAT in the pleiades genes project (TF0000105, TF0000121, TF0000137, TF0000146)." ; family "BetaBetaAlpha-zinc finger" ; medline "17916232" ; pazar_tf_id "TF0000055" ; species "9606,10090,10116" ; tax_group "vertebrates" ; type "COMPILED" PB0007.1 13.7408970260716 Bhlhb2 Zipper-Type ; acc "O35185" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Helix-Loop-Helix " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0094.1 24.8567798112583 LM94 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WRGMAAATTSAATTTKCMWWW" ; medline "17442748" ; species "9606" MF0009.1 6.40223313941086 TRP(MYB) class TRP ; acc "" ; collection "FAM" ; comment "-" ; included_models " MA0034,MA0050,MA0051,MA0054,MA0100" ; medline "15066426" ; species "" ; type "METAMODEL" PF0070.1 13.0053062046387 CGTSACG Unknown ; MCS "17.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "PAX-3" ; type "phylogenetic" MA0283.1 11.2361685710842 CHA4 Zinc-coordinating ; acc "YLR098C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" CN0058.1 23.4925658167972 LM58 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CATAAATCACAGCTKH" ; medline "17442748" ; species "9606" MA0023.1 14.1230520913631 dl_2 Ig-fold ; acc "P15330" ; collection "CORE" ; comment "dl has a dual binding specificity and therefore two models: MA0022 and MA0023" ; family "Rel Homology Region" ; medline "1582412" ; species "7227" ; tax_group "insects" ; type "SELEX" MA0054.1 8.56143865224759 myb.Ph3 Helix-Turn-Helix ; acc "Q02994" ; collection "CORE" ; comment "-" ; family "Myb" ; medline "7737128" ; species "4102" ; tax_group "plants" ; type "SELEX" MA0355.1 8.02076073548503 PHD1 Other ; acc "YKL043W" ; collection "CORE" ; family "KilA-N" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PH0153.1 14.1165172767094 Prop1 Helix-Turn-Helix ; acc "P97458" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0065.2 11.6630620376181 PPARG::RXRA Zinc-coordinating ; acc "P37238,P28700" ; collection "CORE" ; comment "Heterodimer between PPARG and RXRA" ; family "Hormone-nuclear Receptor" ; medline "18981474" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" CN0201.1 23.3636148924881 LM201 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTTTCAAAGGCTCATTA" ; medline "17442748" ; species "9606" CN0233.1 24.3505370585227 LM233 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGTTGATTCTTTCCAGGAAA" ; medline "17442748" ; species "9606" MA0348.1 10.3464401067094 OAF1 Zinc-coordinating ; acc "YAL051W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PB0030.1 12.6224128627095 Hnf4a Zinc-coordinating ; acc "P49698" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Hormone-nuclear Receptor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0314.1 15.5165249852544 HAP3 Other Alpha-Helix ; acc "YBL021C" ; collection "CORE" ; family "NF-Y CCAAT-Binding Protein" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" CN0003.1 21.3718399470909 LM3 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "KGTTGCTWRGCAACM" ; medline "17442748" ; species "9606" PL0010.1 10.3437692505246 hlh-2::hlh-19 Zipper-type ; acc "Q17588,Q20941" ; collection "PBM_HLH" ; comment "heterodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" CN0149.1 23.4669238548993 LM149 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TTGCTTTCAAATGCCAGGA" ; medline "17442748" ; species "9606" MA0372.1 11.754351535133 RPH1 Zinc-coordinating ; acc "YER169W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" SD0002.1 12.3393140803366 at_AC_acceptor Unknown ; acc "" ; collection "SPLICE" ; comment "-" ; description "Non-canonical splice acceptor (3') site (at_AC)" ; medline "15475254" ; species "" CN0066.1 23.136319024744 LM66 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GAATGATTAATGACY" ; medline "17442748" ; species "9606" MA0227.1 10.4094093488699 hth Helix-Turn-Helix ; acc "O46339" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0400.1 14.5151426884582 SUT2 Zinc-coordinating ; acc "YPR009W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" MA0033.1 6.06853671151551 FOXL1 Winged Helix-Turn-Helix ; acc "Q12952" ; collection "CORE" ; comment "-" ; family "Forkhead" ; medline "7957066" ; pazar_tf_id "TF0000021" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" CN0046.1 20.0283693584513 LM46 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "ARCAGCTGTTSAAA" ; medline "17442748" ; species "9606" MA0218.1 8.34436833001639 ct Helix-Turn-Helix ; acc "P10180" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MF0010.1 6.07722094833639 Homeobox class Homeo ; acc "" ; collection "FAM" ; comment "-" ; included_models "MA0008,MA0027,MA0046,MA0063,MA0068,MA0070,MA0075,MA0094" ; medline "15066426" ; species "" ; type "METAMODEL" MA0094.2 11.7880868265221 Ubx Helix-Turn-Helix ; acc "P83949" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PH0002.1 13.4895446303888 Alx4 Helix-Turn-Helix ; acc "O35137" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PL0008.1 13.0469439689207 hlh-29 Zipper-type ; acc "Q19917" ; collection "PBM_HLH" ; comment "homodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" PH0031.1 13.1363164187002 Evx1 Helix-Turn-Helix ; acc "P23683" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0174.1 13.0048977287358 WTGAAAT Unknown ; MCS "8.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PF0084.1 17.0715221408565 RGTTAMWNATT Unknown ; MCS "15.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "HNF-1" ; type "phylogenetic" MA0011.1 7.72345967810759 br_Z2 Zinc-coordinating ; acc "Q01295-4" ; collection "CORE" ; comment "Different splice forms affect DNA binding: four matrices" ; family "BetaBetaAlpha-zinc finger" ; medline "8062827" ; pazar_tf_id "TF0000008" ; species "7227" ; tax_group "insects" ; type "COMPILED" CN0218.1 23.7930395929081 LM218 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GAAAATGGGCTGTTT" ; medline "17442748" ; species "9606" PH0141.1 14.7260532450314 Pknox2 Helix-Turn-Helix ; acc "Q8BG99" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0105.1 23.0217440403128 LM105 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTCCCATTGACTTCAATGG" ; medline "17442748" ; species "9606" PB0072.1 12.5147507126017 Sox7 Other Alpha-Helix ; acc "P40646" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0240.1 11.3907481048057 repo Helix-Turn-Helix ; acc "Q24477" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PH0084.1 13.3814243192356 Irx3_2 Helix-Turn-Helix ; acc "P81067" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0024.1 12.2463344586544 Gcm1 Zinc-coordinating ; acc "P70348" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Glial Cells Missing (GCM) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0095.1 15.0748333637152 GCCNNNWTAAR Unknown ; MCS "13.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PH0066.1 14.6116506538805 Hoxc11 Helix-Turn-Helix ; acc "P31312" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0413.1 15.8624146130698 USV1 Zinc-coordinating ; acc "YPL230W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" PB0026.1 14.7249194770805 Zscan4c Zinc-coordinating ; acc "Q3URS2" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MF0005.1 10.3094355478249 Forkhead class Forkhead ; acc "" ; collection "FAM" ; comment "-" ; included_models "MA0030,MA0031,MA0032,MA0033,MA0040,MA0041,MA0042,MA0047" ; medline "15066426" ; species "" ; type "METAMODEL" MA0147.1 11.1572392768441 Myc Zipper-Type ; acc "P01108" ; collection "CORE" ; comment "-" ; family "Helix-Loop-Helix" ; medline "18555785" ; pazar_tf_id "TF0000420" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" CN0222.1 23.9969912530281 LM222 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TTGGAAAGACTTCAAAGA" ; medline "17442748" ; species "9606" MA0005.1 9.09439842911724 AG Other Alpha-Helix ; acc "P17839" ; collection "CORE" ; comment "dimer" ; family "MADS Box" ; medline "7901838" ; species "3702" ; tax_group "plants" ; type "SELEX" MA0089.1 7.9381437011596 NFE2L1::MafG Zipper-Type ; acc "Q14494,Q90889" ; collection "CORE" ; comment "Heterodimer between TCF11 and Mafg" ; family "Leucine Zipper" ; medline "9421508" ; pazar_tf_id "TF0000063" ; species "9031" ; tax_group "vertebrates" ; type "SELEX" MA0410.1 11.0215048954627 UGA3 Zinc-coordinating ; acc "YDL170W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" CN0134.1 24.189676919438 LM134 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTTAATTAGCTGWA" ; medline "17442748" ; species "9606" MA0377.1 10.9537317683742 SFL1 Winged Helix-Turn-Helix ; acc "YOR140W" ; collection "CORE" ; family "Transcription Factor" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" PH0041.1 13.5993100628548 Hmx1 Helix-Turn-Helix ; acc "O70218" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0122.1 15.3812409727179 Obox2 Helix-Turn-Helix ; acc "Q8VHG7" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0166.1 23.0591356107137 LM166 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CATGCTGAGATCAA" ; medline "17442748" ; species "9606" PH0026.1 15.2510940926398 Duxbl Helix-Turn-Helix ; acc "Q3UY88" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0012.1 9.33723168511452 br_Z3 Zinc-coordinating ; acc "Q01295-2" ; collection "CORE" ; comment "Different splice forms affect DNA binding: four matrices" ; family "BetaBetaAlpha-zinc finger" ; medline "8062827" ; pazar_tf_id "TF0000009" ; species "7227" ; tax_group "insects" ; type "COMPILED" PB0010.1 14.3249921578497 Egr1 Zinc-coordinating ; acc "P08046" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PL0016.1 14.7939049583701 ref-1 Zipper-type ; acc "Q22069" ; collection "PBM_HLH" ; comment "homodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" PB0001.1 9.18274815201174 Arid3a Helix-Turn-Helix ; acc "Q62431" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Arid " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0139.1 15.1882530235194 Pitx3 Helix-Turn-Helix ; acc "O35160" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0104.1 15.3137725885187 Meis2 Helix-Turn-Helix ; acc "P97367" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0132.1 9.03956138518612 Pdx1 Helix-Turn-Helix ; acc "NP_032840" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "14704343" ; pazar_tf_id "TF0000824" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" CN0075.1 23.1321356507585 LM75 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CAATTTGCAATTCADW" ; medline "17442748" ; species "9606" MA0316.1 13.3921040128677 HAP5 Other Alpha-Helix ; acc "YOR358W" ; collection "CORE" ; family "NF-Y CCAAT-Binding Protein" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" CN0022.1 21.7771243115557 LM22 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CAGCTGTTWAACAGCTG" ; medline "17442748" ; species "9606" PB0013.1 13.7959993558201 Eomes Beta-Hairpin-Ribbon ; acc "O54839" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Transcription Factor T" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0110.1 26.2951091725639 LM110 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "ATTTCCTGGGGATTAATGACY" ; medline "17442748" ; species "9606" PF0043.1 19.9420272952388 GTTGNYNNRGNAAC Unknown ; MCS "23.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0249.1 10.0176678436754 twi Zipper-type ; acc "P10627" ; collection "CORE" ; comment "-" ; family "Helix-Loop-Helix" ; medline "15572468" ; species "7227" ; tax_group "insects" ; type "DNaseI footprinting" PB0036.1 13.9365646125054 Irf9 Winged Helix-Turn-Helix ; acc "Q61179" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Interferon Regulatory Factor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0127.1 23.2419762025656 LM127 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TTTTGACAGCTCAG" ; medline "17442748" ; species "9606" PH0078.1 12.8762880483715 Hoxd13 Helix-Turn-Helix ; acc "P70217" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0277.1 11.5250621621078 AZF1 Zinc-coordinating ; acc "YOR113W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0427.1 7.92978162553499 YJL103C Zinc-coordinating ; acc "YJL103C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" CN0164.1 23.8746324163003 LM164 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TTGAAATGAAATGTGAC" ; medline "17442748" ; species "9606" MA0035.1 5.73662622978588 Gata1 Zinc-coordinating ; acc "P17679" ; collection "CORE" ; comment "-" ; family "GATA" ; medline "8321207" ; pazar_tf_id "TF0000022" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" PH0101.1 14.5902929450055 Lmx1b Helix-Turn-Helix ; acc "O88609" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0255.1 8.72334582131037 z Helix-Turn-Helix ; acc "P09956" ; collection "CORE" ; comment "-" ; family "Zeste" ; medline "15572468" ; species "7227" ; tax_group "insects" ; type "DNaseI footprinting" MA0066.1 20.3650558402138 PPARG Zinc-coordinating ; acc "P37231" ; collection "CORE" ; comment "-" ; family "Hormone-nuclear Receptor" ; medline "11139380" ; pazar_tf_id "TF0000042" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" MA0111.1 11.9065419262377 Spz1 Other ; acc "AAK15458" ; collection "CORE" ; comment "-" ; family "Other" ; medline "11165476" ; pazar_tf_id "TF0000079" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" MA0320.1 13.8307828297108 IME1 Other ; acc "YJR094C" ; collection "CORE" ; family "Other" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" MA0366.1 8.99230242469699 RGM1 Zinc-coordinating ; acc "YMR182C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" CN0027.1 23.8959198763857 LM27 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "ATTTGCATSTCATTWGCA" ; medline "17442748" ; species "9606" PH0148.1 14.1392509280878 Pou3f3 Helix-Turn-Helix ; acc "P31361" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0050.1 14.0803579444063 Osr2 Zinc-coordinating ; acc "Q91ZD1" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0028.1 8.81228541287854 ELK1 Winged Helix-Turn-Helix ; acc "P19419" ; collection "CORE" ; comment "-" ; family "Ets" ; medline "1425594" ; pazar_tf_id "TF0000017" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" CN0184.1 22.8604735660693 LM184 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTGCCCTTGATTTG" ; medline "17442748" ; species "9606" PF0047.1 13.0000101566652 TGCCAAR Unknown ; MCS "22.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "Hox11-CTF1" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "NF-1" ; type "phylogenetic" MA0139.1 17.205108119684 CTCF Zinc-coordinating ; acc "P49711" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "17512414 " ; pazar_tf_id "TF0000607" ; species "9606" ; tax_group "vertebrates" ; type "ChiP-seq" CN0052.1 28.0018706101454 LM52 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "RYVTAATTAGGAAGGTAAATM" ; medline "17442748" ; species "9606" PF0068.1 13.0493301441172 RGAANNTTC Unknown ; MCS "17.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "HSF1" ; type "phylogenetic" PF0108.1 15.8580414595794 AACWWCAANK Unknown ; MCS "12.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "FAC1(*)" ; type "phylogenetic" PH0001.1 14.5219080640989 Alx3 Helix-Turn-Helix ; acc "O70137" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0048.1 23.3249924223388 LM48 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "YTAATGAGCTCATTAR" ; medline "17442748" ; species "9606" MA0108.1 10.1980738528127 TBP Beta-sheet ; acc "" ; collection "CORE" ; comment "-" ; family "TATA box-binding" ; medline "2329577" ; species "" ; tax_group "vertebrates" PH0085.1 11.9055286760663 Irx4 Helix-Turn-Helix ; acc "Q9QY61" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0038.1 9.47016680639999 Gfi Zinc-coordinating ; acc "Q07120" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "8754800" ; pazar_tf_id "TF0000025" ; species "10116" ; tax_group "vertebrates" ; type "SELEX" MA0125.1 9.57325017965508 Nobox Helix-Turn-Helix ; acc "Q8VIH1" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "16997917" ; pazar_tf_id "TF0000820" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" PH0097.1 12.7008101306894 Lhx6_2 Helix-Turn-Helix ; acc "Q9R1R0" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0138.1 22.9583305401171 REST Zinc-coordinating ; acc "NP_005603" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "-" ; pazar_tf_id "TF0000830" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" CN0180.1 23.8116243822919 LM180 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "KWTTTCATTTGAATGCT" ; medline "17442748" ; species "9606" MA0362.1 10.1804339621107 RDS2 Zinc-coordinating ; acc "YPL133C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0120.1 7.72439203551961 id1 Zinc-coordinating ; acc "AAC18941" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "15020707" ; species "4577" ; tax_group "plants" ; type "SELEX" MA0015.1 10.9770931714416 Cf2_II Zinc-coordinating ; acc "P20385" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "1290524" ; species "7227" ; tax_group "insects" ; type "SELEX" MA0129.1 9.7969611783168 TGA1A Zipper-Type ; acc "CAA34468" ; collection "CORE" ; comment "-" ; family "Leucine Zipper" ; medline "10561063" ; species "4094" ; tax_group "plants" ; type "SELEX" PF0167.1 15.7543754111121 CCTNTMAGA Unknown ; MCS "9.6" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0272.1 11.6555557488392 ARG81 Zinc-coordinating ; acc "YML099C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" CN0062.1 20.1946152010481 LM62 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "AATTGCTTCCAGATG" ; medline "17442748" ; species "9606" PH0088.1 11.4214764551471 Isl2 Helix-Turn-Helix ; acc "Q9CXV0" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0124.1 22.5881500368539 LM124 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "YTGCCAAATGGAAAW" ; medline "17442748" ; species "9606" MF0007.1 7.72446306243099 bHLH(zip) class bHLH(zip) ; acc "" ; collection "FAM" ; comment "-" ; included_models "MA0004,MA0006,MA0048,MA0055,MA0058, MA0059,MA0091,MA0092,MA0093,MA0104" ; medline "15066426" ; species "" ; type "METAMODEL" MA0055.1 15.9141418791189 Myf Zipper-Type ; acc "" ; collection "CORE" ; comment "-" ; family "Helix-Loop-Helix" ; medline "9571041" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" MA0357.1 11.0029849196491 PHO4 Zipper-Type ; acc "YFR034C" ; collection "CORE" ; family "Helix-Loop-Helix" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" CN0037.1 23.0541404787858 LM37 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "YATGCAAATGAGCCM" ; medline "17442748" ; species "9606" PH0082.1 13.792043665802 Irx2 Helix-Turn-Helix ; acc "P81066" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0175.1 22.7565022477221 LM175 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTGTTGACAGTAAA" ; medline "17442748" ; species "9606" MA0330.1 9.81950176103914 MBP1::SWI6 Ig-fold ; acc "YDL056W" ; collection "CORE" ; family "Rel Homology Region" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" MA0275.1 9.09626563225961 ASG1 Zinc-coordinating ; acc "YIL130W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0099.2 9.19332543812042 AP1 Zipper-Type ; acc "P05412,P01100" ; collection "CORE" ; comment "Dimer. Annotations from PAZAR C-JUN + JUN_RAT + JUN_MOUSE + JUN_HUMAN + FOS/JUN_HUMAN + FOS_HUMAN in the pleiades genes project (TF0000129, TF0000147, TF0000234, TF0000243, TF0000670, TF0000287)." ; family "Leucine Zipper" ; medline "17916232" ; pazar_tf_id "TF0000071" ; species "9606,10116,10090" ; tax_group "vertebrates" ; type "COMPILED" CN0016.1 23.3132593748501 LM16 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTTTGARATCCTYAGATGAAAGR" ; medline "17442748" ; species "9606" PH0020.1 12.1294020195637 Dlx1 Helix-Turn-Helix ; acc "Q64317" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0113.1 25.7958286123747 LM113 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WYTGTTTTKCTTGGCA" ; medline "17442748" ; species "9606" MA0434.1 10.8489060465005 YPR013C Zinc-coordinating ; acc "YPR013C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" CN0183.1 22.8347988531333 LM183 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "AGCTGTCATTCTTGGAA" ; medline "17442748" ; species "9606" CN0112.1 24.5271536804108 LM112 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTCATTTGCATATTC" ; medline "17442748" ; species "9606" CN0029.1 23.5017994831121 LM29 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WGCTAATTGCAAATG" ; medline "17442748" ; species "9606" POL007.1 1.31756354163441 BREd Unknown ; Description "Core promoter element that is recognised by TFIIB located downstream of the TATA-box." ; End relative to TSS "-17 " ; Start relative to TSS "-23" ; acc "" ; collection "POLII" ; comment "-" ; medline "16230532 " ; species "" MA0085.1 16.6733068362852 Su(H) Other ; acc "P28159" ; collection "CORE" ; comment "-" ; family "DNA-binding LAG-1-like" ; medline "7590239" ; pazar_tf_id "TF0000060" ; species "7227" ; tax_group "insects" ; type "COMPILED" PB0083.1 13.4701618065623 Tcf7l2 Other Alpha-Helix ; acc "Q924A0" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0174.1 11.7018548491893 Vax1 Helix-Turn-Helix ; acc "Q2NKI2" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0378.1 12.5288363150423 SFP1 Zinc-coordinating ; acc "YLR403W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" MA0265.1 11.7446627847401 ABF1 Zinc-coordinating ; acc "YKL112W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" CN0013.1 26 LM13 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WTGCTAATTAGCA" ; medline "17442748" ; species "9606" MA0319.1 10.0936537569331 HSF1 Winged Helix-Turn-Helix ; acc "YGL073W" ; collection "CORE" ; family "Transcription Factor" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0340.1 9.41503749927884 MOT3 Zinc-coordinating ; acc "YMR070W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" CN0168.1 22.4792810838903 LM168 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GCTTGTCAGAAACA" ; medline "17442748" ; species "9606" PH0169.1 14.642545401328 Tgif1 Helix-Turn-Helix ; acc "" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0146.1 14.2106260290607 Pou3f1 Helix-Turn-Helix ; acc "P21952" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0087.1 10.8307137071314 Sox5 Other Alpha-Helix ; acc "P35710" ; collection "CORE" ; comment "-" ; family "High Mobility Group (Box)" ; medline "1396566" ; pazar_tf_id "TF0000062" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" CN0099.1 22.4431552384205 LM99 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "DSAGGAAATGACTCA" ; medline "17442748" ; species "9606" CN0053.1 21.690876286111 LM53 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TCATTTGCATTKCAAAT" ; medline "17442748" ; species "9606" MA0174.1 9.40538072901653 CG42234 Helix-Turn-Helix ; acc "Q9W064" ; collection "CORE" ; comment "formerly CG12361" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PF0121.1 16.4054352247606 CCAWWNAAGG Unknown ; MCS "11.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "SRF" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "SRF" ; type "phylogenetic" CN0095.1 23.5439864925077 LM95 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "YTGCTCTSTAATTAG" ; medline "17442748" ; species "9606" PB0017.1 13.3108011429449 Foxj3 Winged Helix-Turn-Helix ; acc "Q8BUR3" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Forkhead " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0072.1 11.4853919531975 Hoxc8 Helix-Turn-Helix ; acc "P09025" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0155.1 14.8617070293245 INSM1 Zinc-coordinating ; acc "Q01101" ; collection "CORE" ; comment "Annotations from PAZAR INSM1_HUMAN (TF0000773) in the TFe project." ; family "BetaBetaAlpha-zinc finger" ; medline "17916232" ; pazar_tf_id "TF0000773" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" PH0112.1 13.1908433830521 Nkx2-3 Helix-Turn-Helix ; acc "P97334" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0062.1 13.8895030261926 GABPA Winged Helix-Turn-Helix ; acc "Q06546" ; collection "CORE" ; comment "-" ; family "Ets" ; medline "8383622" ; pazar_tf_id "TF0000039" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" PH0128.1 15.4750252843271 Otp Helix-Turn-Helix ; acc "O09113" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0083.1 24.8026372819834 LM83 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTGTCAAAATCAAT" ; medline "17442748" ; species "9606" MA0409.1 11.8005439676716 TYE7 Zipper-Type ; acc "YOR344C" ; collection "CORE" ; family "Helix-Loop-Helix" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" CN0061.1 24.9768450611339 LM61 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGTCAGCATTTCCATTATRA" ; medline "17442748" ; species "9606" MA0304.1 11.5296732523564 GCR1 Other ; acc "YPL075W" ; collection "CORE" ; family "Other" ; medline "10487868" ; species "4932" ; tax_group "fungi" ; type "COMPILED" MA0399.1 7.49076039445363 SUT1 Zinc-coordinating ; acc "YGL162W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" PH0175.1 12.1464446887961 Vax2 Helix-Turn-Helix ; acc "Q9WTP9" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0005.1 10.6110917817928 Bbx Other Alpha-Helix ; acc "Q8VBW5" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box)" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0057.1 16 ACCTGTTG Unknown ; MCS "20.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0231.1 8.02161083249356 lbe Helix-Turn-Helix ; acc "Q9VDA1" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PH0149.1 13.7813515695082 Pou3f4 Helix-Turn-Helix ; acc "P62515" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0163.1 15.0783312276132 Six3 Helix-Turn-Helix ; acc "Q62233" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0425.1 10.258963128398 YGR067C Zinc-coordinating ; acc "YGR067C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PH0130.1 13.5985980913496 Otx2 Helix-Turn-Helix ; acc "P80206" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0107.1 13.931111951044 Msx2 Helix-Turn-Helix ; acc "Q03358" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0152.1 15.6992705041585 Pou6f1_2 Helix-Turn-Helix ; acc "Q07916" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0060.1 12.6755052763507 Hoxb5 Helix-Turn-Helix ; acc "P09079" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0138.1 15.4141113795629 MYAATNNNNNNNGGC Unknown ; MCS "11.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PH0093.1 15.7396458163337 Lhx3 Helix-Turn-Helix ; acc "P50481" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0038.1 16 TGACCTTG Unknown ; MCS "25.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "RORA" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "ERRALPHA" ; type "phylogenetic" MA0220.1 10.9344189565277 en Helix-Turn-Helix ; acc "P02836" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0050.1 16.0080101497756 IRF1 Winged Helix-Turn-Helix ; acc "P10914" ; collection "CORE" ; comment "-" ; family "Interferon Regulatory Factor" ; medline "7687740" ; pazar_tf_id "TF0000032" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" PF0094.1 14.0741583645298 TGATTTRY Unknown ; MCS "13.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "Gfi" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "GFI-1" ; type "phylogenetic" MA0207.1 10.5824265789565 achi Helix-Turn-Helix ; acc "A1Z916" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0115.1 27.8780468034389 NR1H2::RXRA Zinc-coordinating ; acc "P55055,P19793" ; collection "CORE" ; comment "heterodimer between NR1H2 and RXR" ; family "Hormone-nuclear Receptor" ; medline "10187832" ; pazar_tf_id "TF0000080" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" MA0351.1 13.3513256785677 DOT6 Helix-Turn-Helix ; acc "YER088C" ; collection "CORE" ; family "Myb" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" PH0160.1 12.5901261909705 Shox2 Helix-Turn-Helix ; acc "P70390" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0073.1 21.9843349945475 LM73 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "ATGGAAACAGATGGT" ; medline "17442748" ; species "9606" PF0116.1 16.1343473680798 KMCATNNWGGA Unknown ; MCS "12.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" POL010.1 6.19324453715487 DCE_S_III Unknown ; Description "The DCE consists of three subelements, and each is distinct from the DPE sequence: S_I is CTTC, S_II is CTGT, and S_III is AGC. S_I resides approximately from +6 to +11, S_II from +16 to +21, and S_III from +30 to +34. (Lee et al.). The matrix are built b" ; End relative to TSS "+34" ; Start relative to TSS "+30" ; acc "" ; collection "POLII" ; comment "-" ; medline "16227614" ; species "" MA0239.1 9.60193933972294 prd Helix-Turn-Helix ; acc "P23758" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "16041365" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" CN0193.1 23.7471950518708 LM193 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GTTCTCTGAAATGAAGT" ; medline "17442748" ; species "9606" PF0131.1 13.0000823381506 GATAAGR Unknown ; MCS "11.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "Evi1" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "GATA-X" ; type "phylogenetic" MA0335.1 13.7997061423573 MET4 Zipper-Type ; acc "YNL103W" ; collection "CORE" ; family "Leucine Zipper" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" MA0032.1 6.50807164809114 FOXC1 Winged Helix-Turn-Helix ; acc "Q12948" ; collection "CORE" ; comment "-" ; family "Forkhead" ; medline "7957066" ; pazar_tf_id "TF0000020" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" MA0298.1 12 FZF1 Zinc-coordinating ; acc "YGL254W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PB0044.1 11.5195019382785 Myb Helix-Turn-Helix ; acc "P06876" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Myb " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0128.1 12.362375216475 EmBP-1 Zipper-Type ; acc "P25032" ; collection "CORE" ; comment "-" ; family "Leucine Zipper" ; medline "10561063" ; species "4565" ; tax_group "plants" ; type "SELEX" PB0053.1 15.5751923432451 Rfx3 Winged Helix-Turn-Helix ; acc "P48381" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "RFX " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0151.1 16.8532575371761 RYAAAKNNNNNNTTGW Unknown ; MCS "10.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PF0071.1 14.1157863137353 SYATTGTG Unknown ; MCS "17.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0336.1 12.2206304473175 MGA1 Winged Helix-Turn-Helix ; acc "YGR249W" ; collection "CORE" ; family "Transcription Factor" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" MA0068.1 11.0044478832836 Pax4 Helix-Turn-Helix ; acc "P32115" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "10567552" ; pazar_tf_id "TF0000044" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" MA0196.1 9.01148283143862 NK7.1 Helix-Turn-Helix ; acc "O61640" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PF0143.1 19.3939103130365 CAGNWMCNNNGAC Unknown ; MCS "10.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" CN0080.1 24.5412801351407 LM80 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "AGCAATTAACCTTY" ; medline "17442748" ; species "9606" MA0325.1 11.542688957044 LYS14 Zinc-coordinating ; acc "YDR034C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" CN0143.1 23.5045583691905 LM143 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CATTAATCAGMATT" ; medline "17442748" ; species "9606" MA0361.1 9.76342404942796 RDS1 Zinc-coordinating ; acc "YCR106W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0124.1 11.1268616865409 NKX3-1 Helix-Turn-Helix ; acc "Q99801" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "10871372" ; pazar_tf_id "TF0000819" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" CN0109.1 24.2923164703666 LM109 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WKCTGTSAWTCAMAR" ; medline "17442748" ; species "9606" CN0205.1 23.908000825804 LM205 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TTTCAAGTCAAAACA" ; medline "17442748" ; species "9606" PF0147.1 16.5063350145917 YAATNANRNNNCAG Unknown ; MCS "10.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PB0043.1 14.2547974122237 Mtf1 Zinc-coordinating ; acc "Q07243" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0121.1 15.829516146631 Obox1 Helix-Turn-Helix ; acc "Q9D350" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0022.1 12.9045842260907 dl_1 Ig-fold ; acc "P15330" ; collection "CORE" ; comment "dl has a dual binding specificity and therefore two models: MA0022 and MA0023" ; family "Rel Homology Region" ; medline "1582412" ; species "7227" ; tax_group "insects" ; type "SELEX" MA0203.1 11.4189030450907 Scr Helix-Turn-Helix ; acc "P09077" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PL0005.1 14.5225614892206 hlh-30 Zipper-type ; acc "P91527" ; collection "PBM_HLH" ; comment "homodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" PF0162.1 14.692517104862 TAANNYSGCG Unknown ; MCS "9.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" CN0126.1 22.9392974244307 LM126 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "YTGCTCTAATTGCA" ; medline "17442748" ; species "9606" PF0129.1 14.0448717153072 RRAGTTGT Unknown ; MCS "11.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0238.1 11.5276807051758 pb Helix-Turn-Helix ; acc "P31264" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" CN0192.1 25.4423882390788 LM192 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WTKWMMTTTKVAAAKKWMAW" ; medline "17442748" ; species "9606" CN0033.1 21.1908979508842 LM33 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GWAATTGGAAACAKCTG" ; medline "17442748" ; species "9606" PL0018.1 16.0449572432308 hlh-25 Zipper-type ; acc "Q18054" ; collection "PBM_HLH" ; comment "homodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" MA0261.1 8.89281451812391 lin-14 Other ; acc "Q21446" ; collection "CORE" ; comment "-" ; family "Other" ; medline "16314527 " ; species "6239" ; tax_group "nematodes" ; type "SELEX" CN0140.1 22.9283589212942 LM140 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GTGACCTTTTGTTC" ; medline "17442748" ; species "9606" PH0044.1 12.7610530812658 Homez Helix-Turn-Helix ; acc "Q80W88" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0004.1 13.2132469210344 Nkx3-2 Helix-Turn-Helix ; acc "P97503" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0210.1 7.63718140901969 ara Helix-Turn-Helix ; acc "Q24248" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PF0079.1 14.0344876453022 WGGAATGY Unknown ; MCS "16.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "TEAD" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "TEF-1" ; type "phylogenetic" MA0332.1 12 MET28 Zipper-Type ; acc "YIR017C" ; collection "CORE" ; family "Leucine Zipper" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" PB0088.1 12.0106172805705 Tcfe2a Zipper-Type ; acc "P15806" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Helix-Loop-Helix " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0346.1 8.10167643031295 NHP6B Other Alpha-Helix ; acc "YBR089C-A" ; collection "CORE" ; family "High Mobility Group (Box)" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" MA0405.1 9.32443747400035 TEA1 Zinc-coordinating ; acc "YOR337W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0308.1 13.3757121553004 GSM1 Zinc-coordinating ; acc "YJL103C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" MA0386.1 14.714399703885 TBP Beta-sheet ; acc "YER148W" ; collection "CORE" ; family "TATA box-binding" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" MA0278.1 15.8458970346948 BAS1 Helix-Turn-Helix ; acc "YKR099W" ; collection "CORE" ; family "Myb" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" PH0008.1 12.0194708213547 Barx2 Helix-Turn-Helix ; acc "O08686" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0154.1 16.8135960068403 RNCTGNYNRNCTGNY Unknown ; MCS "10.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0422.1 11.4055232158927 YDR520C Zinc-coordinating ; acc "YDR520C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0327.1 13 MATA1 Helix-Turn-Helix ; acc "YCR97W" ; collection "CORE" ; family "Homeo" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" CN0133.1 22.4359583641439 LM133 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "ACAGCCATAAATCAC" ; medline "17442748" ; species "9606" PH0094.1 13.0947085709642 Lhx4 Helix-Turn-Helix ; acc "P53776" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0089.1 23.7300516279747 LM89 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GTAATTGATTCCAGATG" ; medline "17442748" ; species "9606" MF0004.1 5.37601831905227 Nuclear Receptor class Nuclear receptor ; acc "" ; collection "FAM" ; comment "-" ; included_models "MA0007,MA0016,MA0017,MA0065,MA0066,MA0071,MA0072,MA0074" ; medline "15066426" ; species "" ; type "METAMODEL" MF0003.1 10.9553785258347 REL class REL ; acc "" ; collection "FAM" ; comment "-" ; included_models "MA0022,MA0023,MA0061,MA0101,MA0105,MA0107" ; medline "15066426" ; species "" ; type "METAMODEL" MA0110.1 12.8142114788194 ATHB-5 Helix-Turn-Helix ; acc "11762265" ; collection "CORE" ; comment "updated matrix since last release" ; family "Homeo" ; medline "11247607" ; species "3702" ; tax_group "plants" ; type "SELEX" CN0144.1 23.5111415837395 LM144 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGCTAATGAGGCCAAGGT" ; medline "17442748" ; species "9606" CN0199.1 22.6897025497925 LM199 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GCTCTGGAAATTTCCAG" ; medline "17442748" ; species "9606" CN0121.1 23.5111886114074 LM121 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "AGCTGCAAATTGCATTC" ; medline "17442748" ; species "9606" CN0152.1 23.8612986107125 LM152 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WRRKAARYSAYTTMTCT" ; medline "17442748" ; species "9606" PH0134.1 10.1896897327579 Pbx1 Helix-Turn-Helix ; acc "P41778" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0133.1 9.91874277433396 Pax7 Helix-Turn-Helix ; acc "P47239" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0028.1 13.3842277857385 Hbp1 Other Alpha-Helix ; acc "Q8R316" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0047.1 12.4332203333019 Foxa2 Winged Helix-Turn-Helix ; acc "P32182" ; collection "CORE" ; comment "-" ; family "Forkhead" ; medline "8139574" ; pazar_tf_id "TF0000029" ; species "10116" ; tax_group "vertebrates" ; type "COMPILED" CN0093.1 22.1638209243471 LM93 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "YAAAGTGCTTTGAGCTCCTTGGA" ; medline "17442748" ; species "9606" PL0002.1 14.7315036406637 hlh-2::hlh-3 Zipper-type ; acc "Q17588,Q22717" ; collection "PBM_HLH" ; comment "heterodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" PL0007.1 13.4240675791408 mxl-3 Zipper-type ; acc "Q18711" ; collection "PBM_HLH" ; comment "homodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" PB0057.1 10.8476112616458 Spi1 Winged Helix-Turn-Helix ; acc "P17433" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Ets " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0392.1 9.01443631660008 STB5 Zinc-coordinating ; acc "YHR178W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0269.1 13.6217781718898 AFT1 Other ; acc "YGL071W" ; collection "CORE" ; family "Other" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" CN0032.1 20.3585125615029 LM32 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTGACATTTYCAAA" ; medline "17442748" ; species "9606" MA0331.1 11.804968670549 MCM1 Other Alpha-Helix ; acc "YMR043W" ; collection "CORE" ; family "MADS Box" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" CN0209.1 23.967721068214 LM209 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CATTTCCTTTGTGGAATGAG" ; medline "17442748" ; species "9606" MA0388.1 9.75124585550647 SPT23 Other ; acc "YKL020C" ; collection "CORE" ; family "Other" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" MA0202.1 11.6613546583819 Rx Helix-Turn-Helix ; acc "Q9W2Q1" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PH0171.1 13.9613008582369 Nkx2-1 Helix-Turn-Helix ; acc "P50220" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0063.1 12.3499533604175 Hoxb8 Helix-Turn-Helix ; acc "P09632" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0015.1 13.5636758680828 Foxa2 Winged Helix-Turn-Helix ; acc "P35583" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Forkhead " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0172.1 16.003427466101 TTGCWCAAY Unknown ; MCS "9.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "C/EBPBETA" ; type "phylogenetic" PF0133.1 16.6548422231793 RYTAAWNNNTGAY Unknown ; MCS "11.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PF0111.1 14.0390973145781 RACCACAR Unknown ; MCS "12.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "RUNX1" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "AML" ; type "phylogenetic" MA0019.1 11.6518212262485 Ddit3::Cebpa Zipper-Type ; acc "Q62857,P05554" ; collection "CORE" ; comment "dimer between Ddit3 and Cebpa" ; family "Leucine Zipper" ; medline "8657121" ; species "10116" ; tax_group "vertebrates" ; type "SELEX" PH0156.1 13.6233680375039 Rax Helix-Turn-Helix ; acc "O35602" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0103.1 18.4778049020768 ACAWNRNSRCGG Unknown ; MCS "13.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0036.1 5.68777359118543 GATA2 Zinc-coordinating ; acc "P23769" ; collection "CORE" ; comment "-" ; family "GATA" ; medline "8321207" ; pazar_tf_id "TF0000023" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" PF0159.1 16.8548444626024 GGCKCATGS Unknown ; MCS "9.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" CN0161.1 22.1779571465156 LM161 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTAATGATTTCCTG" ; medline "17442748" ; species "9606" CN0001.1 18.7548948672918 LM1 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "YKGTTKCCATGGMAACMR" ; medline "17442748" ; species "9606" PH0095.1 14.8289244791633 Lhx5 Helix-Turn-Helix ; acc "P61375" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0135.1 13.0540742658084 Phox2a Helix-Turn-Helix ; acc "Q62066" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0163.1 17.12910262009 GGARNTKYCCA Unknown ; MCS "9.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0189.1 9.21447695220147 E5 Helix-Turn-Helix ; acc "Q9VFQ3" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0161.1 6.98267909425061 NFIC Other ; acc "P08651" ; collection "CORE" ; comment "Half-site reported based on MEME analysis of SELEX sequences" ; family "Nuclear Factor I-CCAAT-binding Transcription Factor (NFI-CTF)" ; medline "12101405" ; pazar_tf_id "TF0000368" ; species "9606" ; tax_group "vertebrates" ; type "High-throughput SELEX SAGE" MA0080.2 9.64024742918024 SPI1 Winged Helix-Turn-Helix ; acc "P17947" ; collection "CORE" ; comment "Annotations from PAZAR PU.1 in the pleiades genes project (TF0000134)." ; family "Ets" ; medline "17916232 " ; pazar_tf_id "TF0000056" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" CN0056.1 24.9100786371029 LM56 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTCATTAATCAAAG" ; medline "17442748" ; species "9606" PB0098.1 15.3320746226117 Zfp691 Zinc-coordinating ; acc "Q3TDE8" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0158.1 15.6163105114081 CCCNNNNNNAAGWT Unknown ; MCS "10.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0217.1 7.45558741625092 caup Helix-Turn-Helix ; acc "P54269" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0007.1 15.703395549218 Ar Zinc-coordinating ; acc "P15207" ; collection "CORE" ; comment "-" ; family "Hormone-nuclear Receptor" ; medline "1491700" ; pazar_tf_id "TF0000005" ; species "10117" ; tax_group "vertebrates" ; type "SELEX" PF0125.1 15.1198084909393 RAAGNYNNCTTY Unknown ; MCS "11.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" CN0129.1 24.3087284745856 LM129 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WGMCAGATGRTMTKKNW" ; medline "17442748" ; species "9606" MA0070.1 14.6408952002356 PBX1 Helix-Turn-Helix ; acc "Q5T486" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "7910944" ; pazar_tf_id "TF0000046" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" MA0060.1 12.9251245779655 NFYA Other Alpha-Helix ; acc "P23511" ; collection "CORE" ; comment "-" ; family "NF-Y CCAAT-Binding Protein" ; medline "9469818" ; species "9606,10090,10116,9031,8355,8364,9913,9986" ; tax_group "vertebrates" ; type "COMPILED" CN0098.1 25.3783034419564 LM98 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GATTTGCATTTCATTTGCAY" ; medline "17442748" ; species "9606" PB0046.1 10.9088659857582 Myf6 Zipper-Type ; acc "P15375" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Helix-Loop-Helix " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0118.1 13.842212288599 Nkx6-1_1 Helix-Turn-Helix ; acc "Q99MA9" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0070.1 12.7473494841574 Hoxc5 Helix-Turn-Helix ; acc "P32043" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0092.1 23.4779881360103 LM92 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTAATTTGATTTGGCAGA" ; medline "17442748" ; species "9606" PH0075.1 11.6838884145493 Hoxd10 Helix-Turn-Helix ; acc "P28359" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0152.1 15.1677708035863 WCAANNNYCAG Unknown ; MCS "10.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PH0048.1 14.6728478386423 Hoxa13 Helix-Turn-Helix ; acc "PQ62424" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0159.1 11.7569608349764 Rhox6 Helix-Turn-Helix ; acc "Q8BPD6" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0051.1 22.8104729274088 LM51 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CATTTGCATATGCAAAT" ; medline "17442748" ; species "9606" PH0053.1 13.2260901128957 Hoxa6 Helix-Turn-Helix ; acc "P09092" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0021.1 20.3301929929989 GGAANCGGAANY Unknown ; MCS "37.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" CN0104.1 23.1811991379051 LM104 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TTGACCTTTAAAGCW" ; medline "17442748" ; species "9606" MA0156.1 12.1208832040133 FEV Winged Helix-Turn-Helix ; acc "Q99581" ; collection "CORE" ; comment "Annotations from PAZAR FEV_RAT + FEV_HUMAN (TF0000158, TF0000163) in the pleiades genes project." ; family "Ets" ; medline "17916232" ; pazar_tf_id "TF0000163" ; species "10116,9606" ; tax_group "vertebrates" ; type "COMPILED" PF0058.1 13.0044028015871 YCATTAA Unknown ; MCS "20.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "IPF1(*)" ; type "phylogenetic" MA0273.1 11.0971354082896 ARO80 Zinc-coordinating ; acc "YDR421W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" CN0170.1 23.6694106453484 LM170 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WNNCTTGTAAWTMAGAR" ; medline "17442748" ; species "9606" MA0024.1 13.8381257170687 E2F1 Winged Helix-Turn-Helix ; acc "NP_005216" ; collection "CORE" ; comment "-" ; family "Transcription Factor" ; medline "1411535" ; pazar_tf_id "TF0000014" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" MA0137.2 13.1188406182014 STAT1 Ig-fold ; acc "Q53XW4" ; collection "CORE" ; comment "-" ; family "Stat Protein" ; medline "17558387" ; pazar_tf_id "TF0000829" ; species "9606" ; tax_group "vertebrates" ; type "ChiP-seq" MA0153.1 7.96992534516199 HNF1B Helix-Turn-Helix ; acc "P56693,P35680" ; collection "CORE" ; comment "Annotations from PAZAR HNF1B_HUMAN + HNF1B_MOUSE (TF0000780, TF0000782) in the TFe project." ; family "Homeo" ; medline "17916232" ; pazar_tf_id "TF0000780" ; species "10116,9606,10090,9606,10090" ; tax_group "vertebrates" ; type "COMPILED" MA0415.1 15.8469438675376 YAP1 Zipper-Type ; acc "YML007W" ; collection "CORE" ; family "Leucine Zipper" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" CN0107.1 24.6655887499234 LM107 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WKMAATTAGCCATCTG" ; medline "17442748" ; species "9606" MA0168.1 10.2596443736303 B-H1 Helix-Turn-Helix ; acc "Q24255" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0122.1 8.54224977193481 Nkx3-2 Helix-Turn-Helix ; acc "P97503" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "12746429" ; pazar_tf_id "TF0000084" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" CN0230.1 23.993025417076 LM230 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGGAATTCAAAACACATT" ; medline "17442748" ; species "9606" CN0034.1 21.9281803506367 LM34 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WSATTTGCATTGCAAATGM" ; medline "17442748" ; species "9606" CN0096.1 23.0285780344639 LM96 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WNNNNNWWMWTWRMWKYWAWKTAR" ; medline "17442748" ; species "9606" MA0041.1 12.9448284802064 Foxd3 Winged Helix-Turn-Helix ; acc "Q63245" ; collection "CORE" ; comment "-" ; family "Forkhead" ; medline "8139574" ; species "10116" ; tax_group "vertebrates" ; type "SELEX" CN0146.1 24.0907530540881 LM146 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CCTYTGCTGCCCTCTWVTG" ; medline "17442748" ; species "9606" PB0090.1 12.7951771056686 Zbtb3 Zinc-coordinating ; acc "Q91X45" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0142.1 14.8078141694759 Pou5f1 Helix-Turn-Helix ; acc "P20263" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18555785" ; pazar_tf_id "-" ; species "10090" ; tax_group "vertebrates" ; type "Chip-seq" PH0014.1 14.8274658995995 Cphx Helix-Turn-Helix ; acc "Q8BX39" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0084.1 22.6877368350239 LM84 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GACATCTGGTKGCAATTTG" ; medline "17442748" ; species "9606" CN0141.1 24.331115467769 LM141 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WGCCAAAMCAAACAGN" ; medline "17442748" ; species "9606" MA0286.1 11.5946833908093 CST6 Zipper-Type ; acc "YIL036W" ; collection "CORE" ; family "Leucine Zipper" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" CN0111.1 24 LM111 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTGACCTACTTT" ; medline "17442748" ; species "9606" MA0401.1 11.9296350390708 SWI4 Ig-fold ; acc "YER111C" ; collection "CORE" ; family "Rel Homology Region" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" CN0231.1 24.3421214508928 LM231 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CCACATCTGGAAAAG" ; medline "17442748" ; species "9606" SA0001.1 8.98345403774424 at_AC_acceptor Unknown ; acc "" ; collection "SPLICE" ; comment "-" ; description "Non-canonical splice acceptor (3') site (at_AC)" ; medline "15475254" ; species "" MA0114.1 9.61741421120951 HNF4A Zinc-coordinating ; acc "P41235" ; collection "CORE" ; comment "-" ; family "Hormone-nuclear Receptor" ; medline "12385991" ; species "" ; tax_group "vertebrates" ; type "COMPILED" MA0318.1 10.7083570785287 HMRA2 Helix-Turn-Helix ; acc "YCR096C" ; collection "CORE" ; family "Homeo" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PH0109.1 12.5138385856952 Nkx1-1 Helix-Turn-Helix ; acc "O08713" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0420.1 11.4350310917037 YBR239C Zinc-coordinating ; acc "YBR239C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PB0039.1 14.2089928905647 Lef1 Other Alpha-Helix ; acc "P27782" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0038.1 13.657081013659 Klf7 Zinc-coordinating ; acc "Q99JB0" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0385.1 7.97809298633165 SOK2 Other ; acc "YMR016C" ; collection "CORE" ; family "KilA-N" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0137.1 18.4309054542189 STAT1 Ig-fold ; acc "Q53XW4" ; collection "CORE" ; comment "-" ; family "Stat Protein" ; medline "17558387" ; pazar_tf_id "TF0000829" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" MA0393.1 10.3114373059978 STE12 Helix-Turn-Helix ; acc "YHR084W" ; collection "CORE" ; family "Homeo" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" CN0050.1 25.9998942976244 LM50 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGGGTAATTACATTCTGYY" ; medline "17442748" ; species "9606" CN0114.1 23.3995604087411 LM114 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TTTCCAATTAAGCT" ; medline "17442748" ; species "9606" MA0312.1 10.1207098487735 HAP1 Zinc-coordinating ; acc "YLR256W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" CN0162.1 23.313636307951 LM162 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "YCATTAGGAAGACAAATGR" ; medline "17442748" ; species "9606" PH0003.1 14.2792730321785 Arx Helix-Turn-Helix ; acc "O35085" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0003.1 7.81209200796467 TFAP2A Zipper-Type ; acc "P05549" ; collection "CORE" ; comment "-" ; family "Helix-Loop-Helix" ; medline "10497269" ; pazar_tf_id "TF0000002" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" MA0379.1 9.57365790930011 SIG1 Zinc-coordinating ; acc "YER068W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0439.1 9.9590652262495 YRR1 Zinc-coordinating ; acc "YOR162C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PF0113.1 19.611252601661 AACYNNNNTTCCS Unknown ; MCS "12.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PL0006.1 11.8527025830916 hlh-2::lin-32 Zipper-type ; acc "Q17588,Q10574" ; collection "PBM_HLH" ; comment "heterodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" MF0008.1 9.66247378819726 MADS class MADS ; acc "" ; collection "FAM" ; comment "-" ; included_models "MA0001,MA0005,MA0052,MA0082,MA0083" ; medline "15066426" ; species "" ; type "METAMODEL" PF0135.1 15.1153861586506 AGCYRWTTC Unknown ; MCS "11.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0057.1 9.40029161122265 MZF1_5-13 Zinc-coordinating ; acc "P28698" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "8114711" ; pazar_tf_id "TF0000036" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" MA0246.1 10.7635738748009 so Helix-Turn-Helix ; acc "Q27350" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0067.1 6.20567063978618 Pax2 Helix-Turn-Helix ; acc "P32114" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "8132558" ; pazar_tf_id "TF0000043" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" PH0138.1 12.9849406716533 Pitx2 Helix-Turn-Helix ; acc "P97474" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0031.1 12.1904692468952 Hoxa3 Helix-Turn-Helix ; acc "P02831" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0138.1 26.1002708535711 LM138 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "ACAAAAGCCAGGAAAT" ; medline "17442748" ; species "9606" MA0354.1 12.263821183904 PDR8 Zinc-coordinating ; acc "YLR266C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PF0023.1 12 TAATTA Unknown ; MCS "37.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "TCF1" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "CHX10" ; type "phylogenetic" MA0198.1 11.3452707897821 OdsH Helix-Turn-Helix ; acc "O96616" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PH0098.1 13.7793757861336 Lhx8 Helix-Turn-Helix ; acc "O35652" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0204.1 10.2007154213659 Six4 Helix-Turn-Helix ; acc "Q9Y1P6" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0002.2 10.4014248709659 RUNX1 Ig-fold ; acc "Q01196" ; collection "CORE" ; comment "Data is from Frank Grosveld's Lab." ; family "Runt" ; medline "-" ; pazar_tf_id "TF0000001" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" MA0359.1 12.6660170473799 RAP1 Helix-Turn-Helix ; acc "YNL216W" ; collection "CORE" ; family "Myb" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PH0110.1 11.8164886808522 Nkx1-2 Helix-Turn-Helix ; acc "P42580" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0023.1 12.5107535494658 Dlx4 Helix-Turn-Helix ; acc "P70436" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0216.1 24.1921364522253 LM216 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TTTCTCTTTGAAACCTGCAA" ; medline "17442748" ; species "9606" MA0131.1 13.1966529939183 MIZF Zinc-coordinating ; acc "Q9BQA5" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "14752047" ; pazar_tf_id "TF0000823" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" MA0387.1 11.2121094420992 SPT2 Other Alpha-Helix ; acc "YER161C" ; collection "CORE" ; family "High Mobility Group (Box)" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" CN0132.1 23.3734828252666 LM132 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TRGTTCTCATTAAG" ; medline "17442748" ; species "9606" MA0390.1 15.9738467476943 STB3 Other ; acc "YDR169C" ; collection "CORE" ; family "Other" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" MA0368.1 12.3213310203631 RIM101 Zinc-coordinating ; acc "YHL027W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PF0033.1 14.3042683633816 YTATTTTNR Unknown ; MCS "26.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "MEF-2" ; type "phylogenetic" MA0148.1 12.5328023736824 FOXA1 Winged Helix-Turn-Helix ; acc "P55317" ; collection "CORE" ; comment "-" ; family "Forkhead" ; medline "18798982" ; pazar_tf_id "TF0000263" ; species "9606" ; tax_group "vertebrates" ; type "ChiP-Seq" PH0035.1 14.0033896816339 Gsc Helix-Turn-Helix ; acc "Q02591" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0155.1 13.2589289259166 WGTTNNNNNAAA Unknown ; MCS "10.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0233.1 7.65684512395282 mirr Helix-Turn-Helix ; acc "O01667" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PH0111.1 13.5677351860668 Nkx2-2 Helix-Turn-Helix ; acc "P42586" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0091.1 11.5973292484701 Zbtb7b Zinc-coordinating ; acc "Q64321" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0301.1 7.47094843508793 GAT3 Zinc-coordinating ; acc "YLR013W" ; collection "CORE" ; family "GATA" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0371.1 15.9427249832917 ROX1 Other Alpha-Helix ; acc "YPR065W" ; collection "CORE" ; family "High Mobility Group (Box)" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" CN0101.1 25.5644512024035 LM101 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "ATTTGCATACATTTGCAT" ; medline "17442748" ; species "9606" PB0096.1 13.3231257158579 Zfp281 Zinc-coordinating ; acc "Q99LI5" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0037.1 15.1848286714398 Jundm2 Zipper-Type ; acc "P97875" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Leucine Zipper " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0088.1 16.9254523550943 GGCNKCCATNK Unknown ; MCS "14.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" CN0115.1 22.9283861763997 LM115 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CAAGATTAATKGCT" ; medline "17442748" ; species "9606" CN0150.1 22.9337346654183 LM150 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CATTAACCTTTAAC" ; medline "17442748" ; species "9606" CN0055.1 23.1977114018334 LM55 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WGCTAATTAGCACTT" ; medline "17442748" ; species "9606" PB0041.1 12.441460656472 Mafk Zipper-Type ; acc "Q61827" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Leucine Zipper " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0224.1 23.4329035924821 LM224 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "AATCATGTTTGAAAG" ; medline "17442748" ; species "9606" PB0078.1 13.2796520022264 Sry Other Alpha-Helix ; acc "Q05738" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0076.1 12 CAGGTA Unknown ; MCS "16.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "AREB6" ; type "phylogenetic" CN0153.1 21.2409786898481 LM153 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "NCTGTGATTAAAGCA" ; medline "17442748" ; species "9606" CN0021.1 25.6661940201692 LM21 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "ATTTGCATNTCATTTGCATW" ; medline "17442748" ; species "9606" PB0082.1 11.8608271249051 Tcf7 Other Alpha-Helix ; acc "Q00417" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0242.1 13.8714481144005 run::Bgb Ig-fold ; acc "P22814,Q24040" ; collection "CORE" ; comment "Bgb is the co-activator with CBF-beta domain" ; family "Runt" ; medline "16041365" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PH0115.1 15.1056337410431 Nkx2-6 Helix-Turn-Helix ; acc "P43688" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0172.1 12.7115623985597 CG11294 Helix-Turn-Helix ; acc "Q9W3C6" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" CN0087.1 24.7943682188293 LM87 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "RNNWWTTGAAGCAATTAGCW" ; medline "17442748" ; species "9606" PB0073.1 10.1662269425122 Sox8 Other Alpha-Helix ; acc "Q04886" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0290.1 38 DAL81 Zinc-coordinating ; acc "YIR023W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" MA0152.1 9.85861516191245 NFATC2 Ig-fold ; acc "Q13469" ; collection "CORE" ; comment "Annotations from PAZAR NFAT1_MOUSE + NFAT1_HUMAN + NFAT1_RAT (TF0000191, TF0000193, TF0000195) in the pleiades genes project." ; family "Rel Homology Region" ; medline "17916232" ; pazar_tf_id "TF0000193" ; species "10090,9606,10116" ; tax_group "vertebrates" ; type "COMPILED" PH0091.1 14.5345052869059 Lhx1 Helix-Turn-Helix ; acc "P63006" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0041.1 13.1751339381587 TGACAGNY Unknown ; MCS "24.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "MEIS1" ; type "phylogenetic" POL013.1 11.0597140413294 MED-1 Unknown ; Description "Downstream core promoter element found in TATA-less promoters sharing similar features with the pgp1 promoter. The matrix is built from 14 promoters identified in the literature similar to the pgp1 promoter. It is often found in promoters with multiple st" ; End relative to TSS "+6 to +116" ; Start relative to TSS "+1 to +110" ; acc "" ; collection "POLII" ; comment "-" ; medline "8530439 " ; species "" CN0190.1 23.7872543408499 LM190 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TTAATGGCCCATGAAATGA" ; medline "17442748" ; species "9606" CN0181.1 23.4159903771542 LM181 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WTTTGGCTTTAATGA" ; medline "17442748" ; species "9606" MA0094.1 5.57649394986978 Ubx Helix-Turn-Helix ; acc "P83949" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "1673656" ; pazar_tf_id "TF0000068" ; species "7227" ; tax_group "insects" ; type "SELEX" MA0076.1 14.123230134165 ELK4 Winged Helix-Turn-Helix ; acc "P28324" ; collection "CORE" ; comment "-" ; family "Ets" ; medline "8524663" ; pazar_tf_id "TF0000052" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" PF0014.1 16 TGACGTCA Unknown ; MCS "44.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "ATF3" ; type "phylogenetic" PL0012.1 12.7987195368346 hlh-2::hlh-8 Zipper-type ; acc "Q17588,Q11094" ; collection "PBM_HLH" ; comment "heterodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" MA0163.1 19.3519112748786 PLAG1 Zinc-coordinating ; acc "Q6DJT9" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "16041365" ; pazar_tf_id "-" ; species "9606" ; tax_group "vertebrates" ; type "bacterial 1-hybrid" PH0083.1 12.9621936208499 Irx3_1 Helix-Turn-Helix ; acc "P81067" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0344.1 11.861331038291 NHP10 Other Alpha-Helix ; acc "YDL002C" ; collection "CORE" ; family "High Mobility Group (Box)" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0176.1 9.41407888461203 CG15696 Helix-Turn-Helix ; acc "Q9VDH9" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PH0123.1 14.8311476408505 Obox3 Helix-Turn-Helix ; acc "Q8VHG6" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0176.1 13.8958515689278 Vsx1 Helix-Turn-Helix ; acc "Q91V10" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0121.1 9.59458248131567 ARR10 Helix-Turn-Helix ; acc "O49397" ; collection "CORE" ; comment "-" ; family "Myb" ; medline "12215502" ; species "3702" ; tax_group "plants" ; type "SELEX" PH0069.1 13.5996529383899 Hoxc4 Helix-Turn-Helix ; acc "Q08624" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0082.1 22.9365545092618 LM82 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "ACTTGACATTTGCA" ; medline "17442748" ; species "9606" MA0052.1 15.7090560936245 MEF2A Other Alpha-Helix ; acc "EAX02249" ; collection "CORE" ; comment "-" ; family "MADS Box" ; medline "1748287" ; pazar_tf_id "TF0000034" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" MA0237.1 7.34150536943737 pan Other Alpha-Helix ; acc "P91943" ; collection "CORE" ; comment "-" ; family "High Mobility Group (Box)" ; medline "15572468" ; species "7227" ; tax_group "insects" ; type "DNaseI footprinting" MA0429.1 8.55982138714816 YLL054C Zinc-coordinating ; acc "YLL054C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" CN0035.1 24.5746338470254 LM35 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WRACTTCAAAGGGAGCTB" ; medline "17442748" ; species "9606" CN0026.1 20.2144787376821 LM26 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WAAACACAGCTGT" ; medline "17442748" ; species "9606" MA0095.1 8.10118850374216 YY1 Zinc-coordinating ; acc "P25490" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "7816599" ; pazar_tf_id "TF0000069" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" CN0182.1 24.215150095924 LM182 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TCATTTTGCAAGTGCAA" ; medline "17442748" ; species "9606" MA0299.1 11.5273660726939 GAL4 Zinc-coordinating ; acc "YPL248C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" MA0209.1 10.8135422763079 ap Helix-Turn-Helix ; acc "P29673" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PH0117.1 12.9106076797827 Nkx3-1 Helix-Turn-Helix ; acc "P97436" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0085.1 16.2160430288651 STTTCRNTTT Unknown ; MCS "14.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "IRF2" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "IRF" ; type "phylogenetic" CN0200.1 29.3110239149889 LM200 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "KNNNTTTAATGGGAAATYTGMWWWK" ; medline "17442748" ; species "9606" PH0055.1 11.8621652130012 Hoxa7_2 Helix-Turn-Helix ; acc "P02830" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0120.1 24.3028392363272 KRCTCNNNNMANAGC Unknown ; MCS "11.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0109.1 7.46926530914378 Hltf Zinc-coordinating ; acc "Q95216" ; collection "CORE" ; comment "updated matrix sincle last release" ; family "GATA" ; medline "12198246" ; species "9986" ; tax_group "vertebrates" ; type "SELEX" PH0030.1 13.9493438906078 Esx1 Helix-Turn-Helix ; acc "Q9Z2U3" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0086.1 24.5037516422175 LM86 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "MAKCTGMYTTTGATY" ; medline "17442748" ; species "9606" MA0440.1 22.0315129199184 ZAP1 Zinc-coordinating ; acc "YJL056C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" PF0028.1 15.1499645212671 CTAWWWATA Unknown ; MCS "32.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "MEF2A" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "RSRFC4" ; type "phylogenetic" CN0194.1 26.1147660982806 LM194 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "AGAGGGCAGCARAGYCCCA" ; medline "17442748" ; species "9606" PH0161.1 13.524720216851 Six1 Helix-Turn-Helix ; acc "Q62231" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0352.1 10.0117868838541 PDR1 Zinc-coordinating ; acc "YGL013C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PB0042.1 12.2626216132962 Max Zipper-Type ; acc "P28574" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Helix-Loop-Helix " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0020.1 14.5611472665864 Gabpa Winged Helix-Turn-Helix ; acc "Q00422" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Ets " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0018.1 12.6045644339298 CREB1 Zipper-Type ; acc "P16220" ; collection "CORE" ; comment "-" ; family "Leucine Zipper" ; medline "8264613" ; pazar_tf_id "TF0000013" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" PB0029.1 13.5082560514089 Hic1 Zinc-coordinating ; acc "Q9R1Y5" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0281.1 12.4705889209419 CBF1 Zipper-Type ; acc "YJR060W" ; collection "CORE" ; family "Helix-Loop-Helix" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PF0083.1 13.0032399233547 TGTTTGY Unknown ; MCS "15.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "Foxd3" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "HNF-3" ; type "phylogenetic" MA0112.1 17.6826360597729 ESR1 Zinc-coordinating ; acc "P03372" ; collection "CORE" ; comment "-" ; family "Hormone-nuclear Receptor" ; medline "15563547" ; species "9606,10090,10116,9031,8355,8364,9913,9986" ; tax_group "vertebrates" ; type "COMPILED" CN0042.1 22.9083601223865 LM42 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "AAGCCTAATTAGCA" ; medline "17442748" ; species "9606" PH0074.1 12.4583063775179 Hoxd1 Helix-Turn-Helix ; acc "Q01822" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0062.1 14.0765210087483 SMTTTTGT Unknown ; MCS "19.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PB0077.1 11.1271628276097 Srf Other Alpha-Helix ; acc "Q9JM73" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "MADS Box " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0074.1 20.4756921397386 LM74 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "AWGCCTTTGAAGTTMW" ; medline "17442748" ; species "9606" PB0067.1 9.17767360506708 Sox1 Other Alpha-Helix ; acc "P53783" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0079.1 10.111671982635 Tbp Beta-sheet ; acc "P29037" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "TATA box-binding " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0061.1 13.3447617958635 NF-kappaB Ig-fold ; acc "" ; collection "CORE" ; comment "-" ; family "Rel Homology Region" ; medline "8449662" ; species "9606,10090,10116,9986" ; tax_group "vertebrates" ; type "COMPILED" MA0021.1 9.00217674837923 Dof3 Zinc-coordinating ; acc "Q41801" ; collection "CORE" ; comment "-" ; family "Dof" ; medline "10074718" ; species "4577" ; tax_group "plants" ; type "SELEX" PH0092.1 12.6959041402819 Lhx2 Helix-Turn-Helix ; acc "Q9Z0S2" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" POL005.1 3.30887839177199 DPE Unknown ; Description "The matrix is generated from the DPE containing sequences found in the Drosophila Core Promoter Database http://www-biology.ucsd.edu/labs/Kadonaga/DCPD.htm ." ; End relative to TSS "+34" ; Start relative to TSS "+26" ; acc "" ; collection "POLII" ; comment "-" ; medline "10848601" ; species "7227" MA0026.1 10.3539445300757 Eip74EF Winged Helix-Turn-Helix ; acc "P20105" ; collection "CORE" ; comment "-" ; family "Ets" ; medline "2208281" ; species "7227" ; tax_group "insects" ; type "SELEX" PH0131.1 13.6039838744675 Pax4 Helix-Turn-Helix ; acc "P32115" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0398.1 9.24448020005008 SUM1 Other ; acc "YDR310C" ; collection "CORE" ; family "AT-hook" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PB0022.1 12.9570969513651 Gata5 Zinc-coordinating ; acc "P97489" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "GATA " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0367.1 9.78784990105933 RGT1 Zinc-coordinating ; acc "YKL038W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PF0157.1 15.8360959354586 KCCGNSWTTT Unknown ; MCS "10.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PH0116.1 13.1719292177523 Nkx2-9 Helix-Turn-Helix ; acc "O70584" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0075.1 9.06306510239134 Prrx2 Helix-Turn-Helix ; acc "Q06348" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "7901837" ; pazar_tf_id "TF0000051" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" PF0086.1 16.1135159736544 GGGNNTTTCC Unknown ; MCS "14.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "RELA" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "NF-KAPPAB" ; type "phylogenetic" CN0155.1 26.3994585330845 LM155 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CACTAGGGKACCATTTAGT" ; medline "17442748" ; species "9606" CN0090.1 24.3606619768356 LM90 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTGGCAGCCTGCCAG" ; medline "17442748" ; species "9606" PH0127.1 10.9101150960192 Nobox Helix-Turn-Helix ; acc "P70367" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0049.1 13.5902493404288 Osr1 Zinc-coordinating ; acc "Q9WVG7" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0070.1 22.7450728903571 LM70 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTGAACAGATGGCC" ; medline "17442748" ; species "9606" MA0140.1 11.2966184456867 Tal1::Gata1 Zipper-Type ; acc "P22091,P17679" ; collection "CORE" ; comment "Heterodimer between TAL1 and GATA1. Data is from Frank Grosveld's Lab." ; family "Helix-Loop-Helix" ; medline "-" ; pazar_tf_id "TF0000022" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" PF0075.1 17.5131498899234 TNCATNTCCYR Unknown ; MCS "16.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "STAT1(*)" ; type "phylogenetic" PF0006.1 13.2331518804852 GGGCGGR Unknown ; MCS "63.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "SP1" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "SP1" ; type "phylogenetic" MA0350.1 13.9466782878458 TOD6 Helix-Turn-Helix ; acc "YBL054W" ; collection "CORE" ; family "Myb" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" PH0096.1 12.5669712217239 Lhx6_1 Helix-Turn-Helix ; acc "Q9R1R0" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0025.1 14.1385069219678 NFIL3 Zipper-Type ; acc "NP_005375" ; collection "CORE" ; comment "-" ; family "Leucine Zipper" ; medline "1620116" ; pazar_tf_id "TF0000015" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" MA0127.1 10.0591277357396 PEND Zipper-Type ; acc "BAD90707" ; collection "CORE" ; comment "-" ; family "Leucine Zipper" ; medline "9973626" ; species "3888" ; tax_group "plants" ; type "SELEX" MA0158.1 8.75888972531638 HOXA5 Helix-Turn-Helix ; acc "P20719" ; collection "CORE" ; comment "Annotations from PAZAR HOXA5_MOUSE + HOXA5_HUMAN (TF0000293, TF0000501) in the pleiades genes project." ; family "Homeo" ; medline "17916232" ; pazar_tf_id "TF0000501" ; species "10090,9606" ; tax_group "vertebrates" ; type "COMPILED" PB0040.1 14.5894412216728 Mafb Zipper-Type ; acc "P54841" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Leucine Zipper " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0095.1 16.7846601118016 Zfp187 Zinc-coordinating ; acc "Q5RJ54" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0008.1 11.8821478649142 HAT5 Helix-Turn-Helix ; acc "Q02283" ; collection "CORE" ; comment "homodimer" ; family "Homeo" ; medline "8253077" ; species "3702" ; tax_group "plants" ; type "SELEX" CN0122.1 23.7177464638423 LM122 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GMAGCTTTTAATGA" ; medline "17442748" ; species "9606" CN0148.1 22.9804080575699 LM148 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CAGATTGACATTTC" ; medline "17442748" ; species "9606" PB0002.1 10.3685890233124 Arid5a Helix-Turn-Helix ; acc "Q8BI45" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Arid" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0074.1 19.3843172792854 GGAMTNNNNNTCCY Unknown ; MCS "16.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" CN0136.1 23.5479252048255 LM136 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "NKYTGCCAAGAGCAACA" ; medline "17442748" ; species "9606" MA0376.1 13.0280370637711 RTG3 Zipper-Type ; acc "YBL103C" ; collection "CORE" ; family "Helix-Loop-Helix" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" PF0134.1 14.0883519500891 CATRRAGC Unknown ; MCS "11.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0145.1 11.6502911096776 Tcfcp2l1 Other ; acc "Q3UNW5" ; collection "CORE" ; comment "-" ; family "CP2 Transcription Factor" ; medline "18555785 " ; pazar_tf_id "-" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" PF0173.1 16.3129279607441 YWATTWNNRGCT Unknown ; MCS "8.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0343.1 14.5670310021016 NDT80 Ig-fold ; acc "YHR124W" ; collection "CORE" ; family "NDT80 / PhoG" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" CN0065.1 21.7486299931811 LM65 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "KCTCATTTGCATTTCAAARR" ; medline "17442748" ; species "9606" MA0338.1 9.18961305039914 MIG2 Zinc-coordinating ; acc "YGL209W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PB0011.1 11.4428767873256 Ehf Winged Helix-Turn-Helix ; acc "Q922E8" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Ets " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0077.1 24.9424396113144 LM77 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "YRGATAATTGAGAGTTGACTR" ; medline "17442748" ; species "9606" MA0073.1 22.2782723704014 RREB1 Zinc-coordinating ; acc "Q92766" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "8816445" ; pazar_tf_id "TF0000049" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" PH0064.1 13.3927893499171 Hoxb9 Helix-Turn-Helix ; acc "P20615" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" SD0003.1 12.2306695437446 at_AC_acceptor Unknown ; acc "" ; collection "SPLICE" ; comment "-" ; description "Non-canonical splice acceptor (3') site (at_AC)" ; medline "15475254" ; species "" MA0104.2 11.10408707833 Mycn Zipper-Type ; acc "P03966" ; collection "CORE" ; comment "-" ; family "Helix-Loop-Helix" ; medline "18555785" ; pazar_tf_id "TF0000075" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-Seq" CN0014.1 23.7373405491338 LM14 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WNATCCAGATGTTTGGCAYYW" ; medline "17442748" ; species "9606" PL0004.1 15.6708635675018 hlh-27 Zipper-type ; acc "Q18056" ; collection "PBM_HLH" ; comment "homodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" PB0076.1 11.9501279025043 Spdef Winged Helix-Turn-Helix ; acc "Q9WTP3" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Ets " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0091.1 15.0711447112168 GTGGGTGK Unknown ; MCS "14.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "RREB1" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PB0070.1 12.8968538027584 Sox4 Other Alpha-Helix ; acc "Q06945" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0431.1 10.8941596185029 YML081W Zinc-coordinating ; acc "YML081W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PB0034.1 13.734786996509 Irf5 Winged Helix-Turn-Helix ; acc "P56477" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Interferon Regulatory Factor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0200.1 10.4572722909208 Pph13 Helix-Turn-Helix ; acc "Q8T0V5" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0133.1 5.26063535577042 BRCA1 Other ; acc "P38398" ; collection "CORE" ; comment "Multi-protein complex" ; family "Other" ; medline "14502648" ; pazar_tf_id "TF0000825" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" PF0080.1 21.1382301888602 SNACANNNYSYAGA Unknown ; MCS "15.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0276.1 10.7334328074025 ASH1 Zinc-coordinating ; acc "YKL185W" ; collection "CORE" ; family "GATA" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" MA0321.1 12.8144402971823 INO2 Zipper-Type ; acc "YDR123C" ; collection "CORE" ; family "Helix-Loop-Helix" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" PB0054.1 14.8618455127864 Rfx4 Winged Helix-Turn-Helix ; acc "Q8HWA6" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "RFX " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0197.1 24.5286416167029 LM197 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "AAAGATGCARTATCCCTTTT" ; medline "17442748" ; species "9606" MA0245.1 9.51955468237743 slou Helix-Turn-Helix ; acc "P22807" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0078.1 10.5018372361999 Sox17 Other Alpha-Helix ; acc "Q61473" ; collection "CORE" ; comment "-" ; family "High Mobility Group (Box)" ; medline "8636240" ; pazar_tf_id "TF0000054" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" PF0067.1 14.4099898423089 TGANNYRGCA Unknown ; MCS "17.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "TCF11/MAFG" ; type "phylogenetic" PF0040.1 14.0600799181782 TTCYNRGAA Unknown ; MCS "24.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "STAT5A" ; type "phylogenetic" MA0178.1 10.5019144943067 CG32105 Helix-Turn-Helix ; acc "Q9VTW5" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PF0044.1 14.8716187921438 YATGNWAAT Unknown ; MCS "23.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "OCT-X" ; type "phylogenetic" CN0232.1 24.4994736532216 LM232 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGGAAGCAGTGAAACAAATG" ; medline "17442748" ; species "9606" MA0253.1 12.8905663562585 vnd Helix-Turn-Helix ; acc "P22808" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0307.1 7.86116233931669 GLN3 Zinc-coordinating ; acc "YER040W" ; collection "CORE" ; family "GATA" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PF0161.1 16.5770786874249 TTANWNANTGGM Unknown ; MCS "9.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" POL012.1 10.1980738528127 TATA-Box Unknown ; Description "The dominating motif TATA ( first T in TATAT) is located in a preferred region from -32 to -28 relative to the TSS (see pub med 16916456). This model is also housed in JASPAR CORE (MA0108)" ; End relative to TSS "-25 to -9" ; Start relative to TSS "-39 to -23" ; acc "" ; collection "POLII" ; comment "-" ; medline "2329577" ; species "" MA0059.1 14.2370460691273 MYC::MAX Zipper-Type ; acc "AAH36092,Q6LBK7" ; collection "CORE" ; comment "Heterodimer of MYC and MAX " ; family "Helix-Loop-Helix" ; medline "8265351" ; pazar_tf_id "TF0000038" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" CN0188.1 23.5208879545282 LM188 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TCTGACAGAAATGTCAA" ; medline "17442748" ; species "9606" MA0191.1 10.3660720181329 HGTX Helix-Turn-Helix ; acc "Q9NHP8" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PF0011.1 15.0359795013411 MGGAAGTG Unknown ; MCS "51.6" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "GABPA" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "GABP" ; type "phylogenetic" PF0078.1 14.500168388317 GCTNWTTGK Unknown ; MCS "16.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0170.1 9.16929973957508 C15 Helix-Turn-Helix ; acc "Q7KS72" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PB0059.1 11.0194253770457 Smad3 Zinc-coordinating ; acc "Q8BUN5" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "MH1 " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0064.1 12.0175401946116 TTANTCA Unknown ; MCS "18.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "AP-1(*)" ; type "phylogenetic" CN0220.1 25.2660551768414 LM220 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "ATGGCACTTTGGAAAATGGA" ; medline "17442748" ; species "9606" MA0432.1 11.9460838565474 YNR063W Zinc-coordinating ; acc "YNR063W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PH0010.1 13.5994379418609 Alx1_1 Helix-Turn-Helix ; acc "Q8C8B0" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0089.1 12.8737946910922 Isx Helix-Turn-Helix ; acc "A1A546" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0009.1 22.0665388934836 LM9 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TTCAGCACCWYGGACAGMKMC" ; medline "17442748" ; species "9606" POL008.1 4.14047794920485 DCE_S_I Unknown ; Description "The DCE consists of three subelements, and each is distinct from the DPE sequence: S_I is CTTC, S_II is CTGT, and S_III is AGC. S_I resides approximately from +6 to +11, S_II from +16 to +21, and S_III from +30 to +34. (Lee et al.). The matrix is built ba" ; End relative to TSS "+11" ; Start relative to TSS "+6" ; acc "" ; collection "POLII" ; comment "-" ; medline "16227614" ; species "" PF0001.1 17.0417134599259 RCGCANGCGY Unknown ; MCS "107.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "NRF-1" ; type "phylogenetic" PF0013.1 12 CTTTGT Unknown ; MCS "46.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "LEF1" ; type "phylogenetic" MA0035.2 10.877868413799 Gata1 Zinc-coordinating ; acc "P17679" ; collection "CORE" ; comment "Data is from Frank Grosveld's Lab. " ; family "GATA" ; medline "-" ; pazar_tf_id "TF0000022" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" MA0426.1 12 YHP1 Helix-Turn-Helix ; acc "YDR451C" ; collection "CORE" ; family "Homeo" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" PB0071.1 12.0195150888603 Sox5 Other Alpha-Helix ; acc "P35710" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0188.1 11.84513333609 Dr Helix-Turn-Helix ; acc "Q03372" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0016.1 13.7920230760767 usp Zinc-coordinating ; acc "P20153" ; collection "CORE" ; comment "-" ; family "Hormone-nuclear Receptor" ; medline "1280827" ; species "7227" ; tax_group "insects" ; type "SELEX" MA0306.1 9.99503776771591 GIS1 Zinc-coordinating ; acc "YDR096W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0315.1 12.4143517923914 HAP4 Other Alpha-Helix ; acc "YKL109W" ; collection "CORE" ; family "NF-Y CCAAT-Binding Protein" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" MA0079.1 9.7185757452318 SP1 Zinc-coordinating ; acc "P08047" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "2192357" ; pazar_tf_id "TF0000055" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" MA0195.1 8.71357094394002 Lim3 Helix-Turn-Helix ; acc "Q9VJ02" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0251.1 10.6608585931509 unpg Helix-Turn-Helix ; acc "Q4V5A3" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0091.1 14.0701377487026 TAL1::TCF3 Zipper-Type ; acc "P17542,P15923" ; collection "CORE" ; comment "Heterodimer between TAL1 and TCF3" ; family "Helix-Loop-Helix" ; medline "8289805" ; pazar_tf_id "TF0000065" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" CN0088.1 23.6319870327433 LM88 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WRGTTAATTGGAATCANW" ; medline "17442748" ; species "9606" PH0100.1 13.6622751564181 Lmx1a Helix-Turn-Helix ; acc "Q9JKU8" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0063.1 22.7972241099222 LM63 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGATTTATGAGGTG" ; medline "17442748" ; species "9606" CN0176.1 24.3378041695922 LM176 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GAGCCAGCTGGCTCM" ; medline "17442748" ; species "9606" PH0034.1 14.1527066083212 Gbx2 Helix-Turn-Helix ; acc "P48031" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0080.1 10.8390773372516 Tcf1 Helix-Turn-Helix ; acc "Q66JY7" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0053.1 18.8958345972212 RYTGCNNRGNAAC Unknown ; MCS "21.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "MIF-1" ; type "phylogenetic" MA0183.1 8.44684290542566 CG7056 Helix-Turn-Helix ; acc "Q9VDF0" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0102.2 8.71217594697575 CEBPA Zipper-Type ; acc "-" ; collection "CORE" ; comment "last 3 nt removed" ; family "Leucine Zipper" ; medline "1672737" ; species "-" ; tax_group "vertebrates" ; type "COMPILED" MA0175.1 10.2453717795788 CG13424 Helix-Turn-Helix ; acc "A1ZBV6" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PF0073.1 12 CTTTGA Unknown ; MCS "17.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "NR1H2-RXR" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "LEF1" ; type "phylogenetic" PB0016.1 10.8067733282855 Foxj1 Winged Helix-Turn-Helix ; acc "Q61660" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Forkhead " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0102.1 9.18699952114279 Cebpa Zipper-Type ; acc "" ; collection "CORE" ; comment "-" ; family "Leucine Zipper" ; medline "1672737" ; species "10090,10116" ; tax_group "vertebrates" ; type "COMPILED" PH0102.1 15.7929524600364 Meis1 Helix-Turn-Helix ; acc "Q60954" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0264.1 12.5462910458534 ceh-22 Helix-Turn-Helix ; acc "P41936" ; collection "CORE" ; comment "NK-2 class; ortholog to Drosophila tinman and vertebrate Nkx2-5" ; family "Homeo" ; medline "16998473" ; species "6239" ; tax_group "nematodes" ; type "PBM" PB0084.1 10.8017848161126 Tcfap2a Zipper-Type ; acc "P34056" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Helix-Loop-Helix " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0148.1 18.2162185369208 GATGKMRGCG Unknown ; MCS "10.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0291.1 9.34099948469802 DAL82 Other ; acc "YNL314W" ; collection "CORE" ; family "Other" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" SA0002.1 9.10739671864104 at_AC_acceptor Unknown ; acc "" ; collection "SPLICE" ; comment "-" ; description "Non-canonical splice acceptor (3') site (at_AC)" ; medline "15475254" ; species "" PH0103.1 11.8789712302861 Meox1 Helix-Turn-Helix ; acc "P32442" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0045.1 14.0837125498192 Hoxa1 Helix-Turn-Helix ; acc "P09022" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0098.1 16.3356838349734 GTCNYYATGR Unknown ; MCS "13.6" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PB0012.1 10.2599592757308 Elf3 Winged Helix-Turn-Helix ; acc "Q3UPW2" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Ets " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0179.1 23.4531875277397 LM179 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "MTKNYWRATKMATYWRKMAR" ; medline "17442748" ; species "9606" MA0063.1 8.26972545955296 Nkx2-5 Helix-Turn-Helix ; acc "P42582" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "7797561" ; pazar_tf_id "TF0000040" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" CN0019.1 24.1392804486059 LM19 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGCTAATTAGCAGCH" ; medline "17442748" ; species "9606" PF0087.1 17.7580202976952 RYTGCNWTGGNR Unknown ; MCS "14.6" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0030.1 14.8237690744434 FOXF2 Winged Helix-Turn-Helix ; acc "Q12947" ; collection "CORE" ; comment "-" ; family "Forkhead" ; medline "7957066" ; pazar_tf_id "TF0000019" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" MA0001.1 10.5882147138157 AGL3 Other Alpha-Helix ; acc "P29383" ; collection "CORE" ; comment "-" ; family "MADS Box" ; medline "7632923" ; species "3702" ; tax_group "plants" ; type "SELEX" PF0069.1 15.4063013735119 SGCGSSAAA Unknown ; MCS "17.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "E2F-1/DP-2" ; type "phylogenetic" PF0096.1 14.0932504690537 YGCANTGCR Unknown ; MCS "13.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0419.1 13.7523924819353 YAP7 Zipper-Type ; acc "YOL028C" ; collection "CORE" ; family "Leucine Zipper" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" MA0193.1 9.65971103980732 Lag1 Helix-Turn-Helix ; acc "Q9W423" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0418.1 11.2313018686508 YAP6 Zipper-Type ; acc "YDR259C" ; collection "CORE" ; family "Leucine Zipper" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" CN0049.1 21.3581245304141 LM49 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "KGTAATTAGCAGCTG" ; medline "17442748" ; species "9606" MA0232.1 8.82456873057686 lbl Helix-Turn-Helix ; acc "P91626" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0219.1 9.02643383861637 ems Helix-Turn-Helix ; acc "P18488" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0223.1 11.3776904659972 exex Helix-Turn-Helix ; acc "Q9VSC2" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PF0140.1 13.0753988391757 RNGTGGGC Unknown ; MCS "10.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PH0037.1 9.63720751970374 Hdx Helix-Turn-Helix ; acc "Q14B70" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0170.1 13.5072984828633 YNGTTNNNATT Unknown ; MCS "9.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" CN0119.1 23.0110085658494 LM119 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "AAACCAATTAGCATC" ; medline "17442748" ; species "9606" PF0153.1 16.2848322108467 CTGRYYYNATT Unknown ; MCS "10.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PF0164.1 16.7009381696348 GCGSCMNTTT Unknown ; MCS "9.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" CN0020.1 19.9745597835393 LM20 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGACAGCTGTCA" ; medline "17442748" ; species "9606" MA0408.1 10.2931677376408 TOS8 Helix-Turn-Helix ; acc "YGL096W" ; collection "CORE" ; family "Homeo" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0071.1 13.1897301896459 RORA_1 Zinc-coordinating ; acc "NP_599023" ; collection "CORE" ; comment "isoform type" ; family "Hormone-nuclear Receptor" ; medline "7926749" ; pazar_tf_id "TF0000047" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" CN0067.1 24.8081709498195 LM67 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WKVAAATGCAATTAAG" ; medline "17442748" ; species "9606" MA0014.1 12.4319608285825 Pax5 Helix-Turn-Helix ; acc "Q02650" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "8406007" ; pazar_tf_id "TF0000011" ; species "10090" ; tax_group "vertebrates" ; type "COMPILED" CN0167.1 25.5945040691493 LM167 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WYTTGACCTTTTCA" ; medline "17442748" ; species "9606" PH0129.1 13.8818157416625 Otx1 Helix-Turn-Helix ; acc "P80205" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0173.1 12.2941430499133 CG11617 Helix-Turn-Helix ; acc "Q9VPL4" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" CN0011.1 26.0708555289977 LM11 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "ATGGAAATGCTGACAGAMCCTTAA" ; medline "17442748" ; species "9606" PH0166.1 13.6801146123483 Six6_2 Helix-Turn-Helix ; acc "Q9QZ28" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0106.1 26.2394386341062 TP53 Zinc-coordinating ; acc "P04637" ; collection "CORE" ; comment "-" ; family "Loop-Sheet-Helix" ; medline "1588974" ; pazar_tf_id "TF0000077" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" PH0113.1 12.7764029072957 Nkx2-4 Helix-Turn-Helix ; acc "Q9EQM3" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0029.1 17.9085403297222 Evi1 Zinc-coordinating ; acc "AAI39763" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "8321231" ; pazar_tf_id "TF0000018" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" MA0329.1 7.28114059219166 MBP1 Ig-fold ; acc "YDL056W" ; collection "CORE" ; family "Rel Homology Region" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" CN0206.1 25.6341341723973 LM206 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GAAAACAGTTTGTTCTCT" ; medline "17442748" ; species "9606" PH0027.1 13.4366403323443 Emx2 Helix-Turn-Helix ; acc "Q04744" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" POL009.1 4.13199510752977 DCE_S_II Unknown ; Description "The DCE consists of three subelements, and each is distinct from the DPE sequence: S_I is CTTC, S_II is CTGT, and S_III is AGC. S_I resides approximately from +6 to +11, S_II from +16 to +21, and S_III from +30 to +34. (Lee et al.). The matrix are built b" ; End relative to TSS "+21" ; Start relative to TSS "+16" ; acc "" ; collection "POLII" ; comment "-" ; medline "16227614" ; species "" PB0094.1 11.880861921635 Zfp161 Zinc-coordinating ; acc "Q08376" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0334.1 9.19224435198672 MET32 Zinc-coordinating ; acc "YDR253C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PH0119.1 13.7859408205041 Nkx6-1_2 Helix-Turn-Helix ; acc "Q99MA9" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PL0015.1 13.3454195705559 hlh-2::hlh-14 Zipper-type ; acc "Q17588,Q09961" ; collection "PBM_HLH" ; comment "heterodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" CN0157.1 22.4542695904819 LM157 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGCCTAATTACACA" ; medline "17442748" ; species "9606" PL0019.1 11.9516201172463 hlh-1 Zipper-type ; acc "P22980" ; collection "PBM_HLH" ; comment "homodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" MA0342.1 9.28104491879008 MSN4 Zinc-coordinating ; acc "YKL062W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0226.1 11.2506365099931 hbn Helix-Turn-Helix ; acc "Q9W2P8" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PH0077.1 15.0727264465251 Hoxd12 Helix-Turn-Helix ; acc "P23812" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0287.1 15.6416628564083 CUP2 Zinc-coordinating ; acc "YGL166W" ; collection "CORE" ; family "Copper fist" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" CN0226.1 23.1640325414535 LM226 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "AAAGCTTTCTTAATG" ; medline "17442748" ; species "9606" MA0100.1 9.88327768496603 Myb Helix-Turn-Helix ; acc "P06876" ; collection "CORE" ; comment "-" ; family "Myb" ; medline "1861984" ; pazar_tf_id "TF0000072" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" MA0250.1 11.1547935707662 unc-4 Helix-Turn-Helix ; acc "O77215" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PB0023.1 11.6107996418003 Gata6 Zinc-coordinating ; acc "Q61169" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "GATA " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0234.1 10.9238153206134 oc Helix-Turn-Helix ; acc "P22810" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0164.1 12.0283841788908 Nr2e3 Zinc-coordinating ; acc "Q9QXZ7" ; collection "CORE" ; family "Hormone-nuclear Receptor" ; medline "15634773" ; pazar_tf_id "-" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" MA0046.1 15.5481691262781 HNF1A Helix-Turn-Helix ; acc "ABR09270" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "9047360" ; species "7742" ; tax_group "vertebrates" ; type "COMPILED" MA0270.1 11.5093514410114 AFT2 Other ; acc "YPL202C" ; collection "CORE" ; family "Other" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PF0019.1 20.4656414702423 GKCGCNNNNNNNTGAYG Unknown ; MCS "40.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PF0104.1 18.6852937354041 CCAATNNSNNNGCG Unknown ; MCS "13.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0412.1 19.2896641173389 UME6 Zinc-coordinating ; acc "YDR207C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" CN0025.1 21.0317487734382 LM25 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "AAARGMAATTKCYTTT" ; medline "17442748" ; species "9606" CN0154.1 23.4173275673741 LM154 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CAKCTGGATGAAAAATG" ; medline "17442748" ; species "9606" MA0180.1 13.4168711191014 Vsx2 Helix-Turn-Helix ; acc "Q9W4B3" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" POL002.1 4.67022136152347 INR Unknown ; Description "The INR consensus PyPyA(+1)NT/APyPy (Smale, Kadonaga 2003) is characterized by an A at the TSS (+1) and a cytosine at position -1. TFIID specific." ; End relative to TSS "+6" ; Start relative to TSS "-2" ; acc "" ; collection "POLII" ; comment "-" ; medline "2329577" ; species "" CN0185.1 23.6543363076089 LM185 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GCTTTGCTTCATTTCAG" ; medline "17442748" ; species "9606" MA0322.1 13.2094516970684 INO4 Zipper-Type ; acc "YOL108C" ; collection "CORE" ; family "Helix-Loop-Helix" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" MA0345.1 10.2490608272115 NHP6A Other Alpha-Helix ; acc "YPR052C" ; collection "CORE" ; family "High Mobility Group (Box)" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" PF0102.1 15.371552469456 ATGGYGGA Unknown ; MCS "13.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PF0016.1 14.0366116741218 RYTTCCTG Unknown ; MCS "43.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "C-ETS-2" ; type "phylogenetic" MA0006.1 9.53241709191153 Arnt::Ahr Zipper-Type ; acc "P30561,P53762" ; collection "CORE" ; comment "dimer" ; family "Helix-Loop-Helix" ; medline "7592839" ; pazar_tf_id "TF0000004" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" CN0203.1 23.0812763638508 LM203 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGACTGTGAAATTACAG" ; medline "17442748" ; species "9606" MA0113.1 14.7489179581357 NR3C1 Zinc-coordinating ; acc "P04150" ; collection "CORE" ; comment "-" ; family "Hormone-nuclear Receptor" ; medline "15563547" ; species "9606,10090,10116,9031,8022" ; tax_group "vertebrates" ; type "COMPILED" MA0042.1 13.1829736117753 FOXI1 Winged Helix-Turn-Helix ; acc "Q12951" ; collection "CORE" ; comment "-" ; family "Forkhead" ; medline "9153225" ; pazar_tf_id "TF0000027" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" PF0036.1 13.0049602985846 RTAAACA Unknown ; MCS "25.6" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "FREAC-2" ; type "phylogenetic" MA0049.1 10.403423261874 hb Zinc-coordinating ; acc "P05084" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "2507923" ; pazar_tf_id "TF0000031" ; species "7227" ; tax_group "insects" ; type "COMPILED" PH0080.1 12.8236376180841 Hoxd8 Helix-Turn-Helix ; acc "P23463" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0007.1 12.110349846871 TGANTCA Unknown ; MCS "62.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "Fos" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "AP-1" ; type "phylogenetic" PH0065.1 14.0151731223195 Hoxc10 Helix-Turn-Helix ; acc "P31257" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0300.1 11.6167498282201 GAT1 Zinc-coordinating ; acc "YFL021W" ; collection "CORE" ; family "GATA" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" CN0223.1 26.752426261018 LM223 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "AGMAGTAATTTACTAAATTG" ; medline "17442748" ; species "9606" MA0214.1 9.66715523834016 bsh Helix-Turn-Helix ; acc "Q04787" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PF0149.1 17.0504660691425 YGACNNYACAR Unknown ; MCS "10.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PF0055.1 12 TGGAAA Unknown ; MCS "21.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "NF-AT" ; type "phylogenetic" CN0117.1 26.4251191691821 LM117 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GATAATTGAGAGTTGAC" ; medline "17442748" ; species "9606" MA0263.1 17.9840978364634 ttx-3::ceh-10 Helix-Turn-Helix ; acc "Q94156,P41935" ; collection "CORE" ; comment "dimer" ; family "Homeo" ; medline "15177025 " ; species "6239" ; tax_group "nematodes" ; type "EMSA" SA0003.1 9.01616174501847 at_AC_acceptor Unknown ; acc "" ; collection "SPLICE" ; comment "-" ; description "Non-canonical splice acceptor (3') site (at_AC)" ; medline "15475254" ; species "" PF0035.1 13.5107278565549 GCANCTGNY Unknown ; MCS "25.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "Myf" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "MYOD" ; type "phylogenetic" MA0358.1 10.5237644825346 PUT3 Zinc-coordinating ; acc "YKL015W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PH0057.1 12.7859606503488 Hoxb13 Helix-Turn-Helix ; acc "P70321" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0081.1 12.2349788683527 Tcf3 Other Alpha-Helix ; acc "Q9Z1J1" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0341.1 8.76523853336397 MSN2 Zinc-coordinating ; acc "YMR037C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PF0018.1 13.8860076750062 TCANNTGAY Unknown ; MCS "40.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "SREBP-1" ; type "phylogenetic" CN0068.1 22.8570135047616 LM68 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WTCATCCAGATGTTTGGY" ; medline "17442748" ; species "9606" PF0106.1 18.4740178263056 CCGNMNNTNACG Unknown ; MCS "12.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0292.1 9.35050814670533 ECM22 Zinc-coordinating ; acc "YLR228C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0433.1 11.6055978609434 YOX1 Helix-Turn-Helix ; acc "YML027W" ; collection "CORE" ; family "Homeo" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" CN0071.1 23.7046410785893 LM71 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGATTAATTGCAAA" ; medline "17442748" ; species "9606" CN0189.1 24.709840615613 LM189 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGYTCATTTGAAAGGWAATR" ; medline "17442748" ; species "9606" CN0147.1 23.2218643671062 LM147 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "MAGAAATCCATTAACW" ; medline "17442748" ; species "9606" PH0022.1 12.8919339838272 Dlx3 Helix-Turn-Helix ; acc "Q64205" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0187.1 9.27304089364794 Dll Helix-Turn-Helix ; acc "P20009" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" CN0078.1 22.6061884041905 LM78 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WTTSCAGGAAATTGCW" ; medline "17442748" ; species "9606" PB0065.1 10.7473942186786 Sox17 Other Alpha-Helix ; acc "Q61473" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0146.1 13.0765950923237 Zfx Zinc-coordinating ; acc "P17012" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "18555785" ; pazar_tf_id "-" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" CN0172.1 25.5442989154849 LM172 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "AAATGAAATTCATTTG" ; medline "17442748" ; species "9606" CN0024.1 23.0121912261049 LM24 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "DGARAACAGATGGCW" ; medline "17442748" ; species "9606" PF0144.1 14.2418901235448 AAANWWTGC Unknown ; MCS "10.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0222.1 11.3622264394499 exd Helix-Turn-Helix ; acc "P40427" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PH0168.1 13.6430312286604 Hnf1b Helix-Turn-Helix ; acc "P27889" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0050.1 12.3831873903492 Hoxa3 Helix-Turn-Helix ; acc "P02831" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0123.1 24.9212641781074 LM123 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WGCTGTCAKTTKTMATK" ; medline "17442748" ; species "9606" MA0065.1 23.4488895332387 PPARG::RXRA Zinc-coordinating ; acc "P37231,P19793" ; collection "CORE" ; comment "Heterodimer between PPARG and RXRA" ; family "Hormone-nuclear Receptor" ; medline "11139380" ; pazar_tf_id "TF0000041" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" MA0374.1 7.97832421428651 RSC3 Zinc-coordinating ; acc "YDR303C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PF0112.1 16.8667694111057 KTGGYRSGAA Unknown ; MCS "12.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PF0029.1 13.0088940575263 CTTTAAR Unknown ; MCS "30.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PH0086.1 12.4011657952795 Irx5 Helix-Turn-Helix ; acc "Q9JKQ4" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0116.1 23.7887526952949 LM116 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WWNAAGHTGAAAATTGCT" ; medline "17442748" ; species "9606" MA0104.1 10.4430512056894 Mycn Zipper-Type ; acc "P03966" ; collection "CORE" ; comment "-" ; family "Helix-Loop-Helix" ; medline "1594445" ; pazar_tf_id "TF0000075" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" PH0051.1 13.7340919310298 Hoxa4 Helix-Turn-Helix ; acc "P06798" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0008.1 18.0536165315128 TMTCGCGANR Unknown ; MCS "55.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PB0004.1 14.6561787543833 Atf1 Zipper-Type ; acc "P81269" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Leucine Zipper " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0092.1 9.04684404277308 Zfp105 Zinc-coordinating ; acc "Q3UHV1" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0019.1 15.4959221906276 Foxl1 Winged Helix-Turn-Helix ; acc "Q64731" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Forkhead " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0435.1 16.7110034522709 YPR015C Zinc-coordinating ; acc "YPR015C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" CN0229.1 23.8220883047563 LM229 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TTTCCATCATAAATC" ; medline "17442748" ; species "9606" PF0109.1 16.3138527051093 YGTCCTTGR Unknown ; MCS "12.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" CN0015.1 21.5544935711601 LM15 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "MATTTGCATGCAAATGA" ; medline "17442748" ; species "9606" PB0066.1 9.97179430311051 Sox18 Other Alpha-Helix ; acc "P43680" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0391.1 11.3895080983534 STB4 Zinc-coordinating ; acc "YMR019W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PH0140.1 15.6549487960567 Pknox1 Helix-Turn-Helix ; acc "O70477" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0068.1 9.84657738916937 Sox21 Other Alpha-Helix ; acc "Q811W0" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0258.1 13.6176585887245 ESR2 Zinc-coordinating ; acc "Q92731" ; collection "CORE" ; comment "-" ; family "Hormone-nuclear Receptor" ; medline "18272478" ; species "9606" ; tax_group "vertebrates" ; type "ChIP-chip" MA0243.1 7.9894000586356 sd Helix-Turn-Helix ; acc "P30052" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "15572468" ; species "7227" ; tax_group "insects" ; type "DNaseI footprinting" PH0018.1 6.89155928111887 Dbx1 Helix-Turn-Helix ; acc "P52950" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0047.1 23.731873920837 LM47 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "AGAGTGCCACCTACTGAAT" ; medline "17442748" ; species "9606" PF0100.1 17.9373932225313 CRGAARNNNNCGA Unknown ; MCS "13.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" CN0007.1 18.3654401914699 LM7 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "NNNCCAGCAGATGGCGCTRT" ; medline "17442748" ; species "9606" MA0084.1 9.193014653455 SRY Other Alpha-Helix ; acc "Q05066" ; collection "CORE" ; comment "-" ; family "High Mobility Group (Box)" ; medline "8190643" ; pazar_tf_id "TF0000059" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" PF0024.1 14.3109738838275 GGGAGGRR Unknown ; MCS "33.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "MAZ" ; type "phylogenetic" MA0165.1 9.59994164678813 Abd-B Helix-Turn-Helix ; acc "P09087" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0160.1 10.1646684725876 NR4A2 Zinc-coordinating ; acc "P43354" ; collection "CORE" ; comment "Annotations from PAZAR NR4A2_MOUSE + NR4A2_RAT + NR4A2_HUMAN (TF0000135, TF0000153, TF0000157) in the pleiades genes project." ; family "Hormone-nuclear Receptor" ; medline "17916232" ; pazar_tf_id "TF0000135" ; species "10090,10116,9606" ; tax_group "vertebrates" ; type "COMPILED" PL0003.1 11.2833069515575 hlh-2::cnd-1 Zipper-type ; acc "Q17588,P46581" ; collection "PBM_HLH" ; comment "heterodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" CN0139.1 23.9425126253881 LM139 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "ACTGACCTACTTTCC" ; medline "17442748" ; species "9606" CN0191.1 23.859667940978 LM191 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "ATCCATTTGTTGCCATGGT" ; medline "17442748" ; species "9606" CN0097.1 23.806312505803 LM97 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CATWAAGCTGTCAG" ; medline "17442748" ; species "9606" PH0040.1 12.8668337639977 Hmbox1 Helix-Turn-Helix ; acc "Q8BJA3" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0107.1 15.4395660004642 RTTTNNNYTGGM Unknown ; MCS "12.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0047.2 13.2676176116311 Foxa2 Winged Helix-Turn-Helix ; acc "P35583" ; collection "CORE" ; comment "-" ; family "Forkhead" ; medline "19553195 " ; pazar_tf_id "TF0000029" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" PF0042.1 13.0127592283486 TGACATY Unknown ; MCS "23.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PF0146.1 14.0696097674866 RRCCGTTA Unknown ; MCS "10.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0285.1 8.316784790192 CRZ1 Zinc-coordinating ; acc "YNL027W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PF0039.1 16.8939815609571 TCCCRNNRTGC Unknown ; MCS "24.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" CN0177.1 23.4922627974238 LM177 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTTTGGCTTCAGACCAAAT" ; medline "17442748" ; species "9606" PH0029.1 12.9952610733464 En2 Helix-Turn-Helix ; acc "P09066" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PL0009.1 13.9863558396788 hlh-26 Zipper-type ; acc "Q18053" ; collection "PBM_HLH" ; comment "homodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" PB0025.1 12.2269963103213 Glis2 Zinc-coordinating ; acc "Q8R4X9" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0369.1 20.6218830256623 RLM1 Other Alpha-Helix ; acc "YPL089C" ; collection "CORE" ; family "MADS Box" ; medline "10487868" ; species "4932" ; tax_group "fungi" ; type "COMPILED" PH0132.1 12.1600000551455 Pax6 Helix-Turn-Helix ; acc "P63015" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0082.1 12.3886856970394 squamosa Other Alpha-Helix ; acc "CAA45228" ; collection "CORE" ; comment "-" ; family "MADS Box" ; medline "9826749" ; species "4151" ; tax_group "plants" ; type "SELEX" MA0064.1 8.5086853429636 PBF Zinc-coordinating ; acc "O24463" ; collection "CORE" ; comment "-" ; family "Dof" ; medline "10074718" ; species "4577" ; tax_group "plants" ; type "SELEX" PF0105.1 18.6154406563166 ACTWSNACTNY Unknown ; MCS "13.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0157.1 11.7336527653393 FOXO3 Winged Helix-Turn-Helix ; acc "O43524" ; collection "CORE" ; comment "Annotations from PAZAR FOXO3_MOUSE + FOXO3_HUMAN (TF0000811, TF0000812) in the TFe project." ; family "Forkhead" ; medline "17916232" ; pazar_tf_id "-" ; species "10090,9606" ; tax_group "vertebrates" ; type "COMPILED" MA0271.1 9.09168920580179 ARG80 Other Alpha-Helix ; acc "YMR042W" ; collection "CORE" ; family "MADS Box" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" CN0118.1 23.4315347136407 LM118 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WSATTTWCWGKAAATSW" ; medline "17442748" ; species "9606" PH0007.1 11.7420127534325 Barx1 Helix-Turn-Helix ; acc "Q9ER42" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0026.1 14.0259308050782 TTAYRTAA Unknown ; MCS "32.6" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "NFIL3" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "E4BP4" ; type "phylogenetic" MA0053.1 8.62904940554533 MNB1A Zinc-coordinating ; acc "P38564" ; collection "CORE" ; comment "-" ; family "Dof" ; medline "10074718" ; species "4577" ; tax_group "plants" ; type "SELEX" MA0309.1 10.2189454478092 GZF3 Zinc-coordinating ; acc "YJL110C" ; collection "CORE" ; family "GATA" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" CN0030.1 23.4560582405832 LM30 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTTTGAAATGTCAAW" ; medline "17442748" ; species "9606" MA0181.1 10.5023614963848 Vsx1 Helix-Turn-Helix ; acc "Q5U1D9" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PB0008.1 11.5565233062986 E2F2 Winged Helix-Turn-Helix ; acc "P56931" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Transcription Factor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0208.1 21.6170213397895 LM208 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGTGAAATGAGTTGG" ; medline "17442748" ; species "9606" CN0108.1 25.0499589793009 LM108 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "YSAATTATCCAGATAATTGCY" ; medline "17442748" ; species "9606" MA0289.1 10.9849382468964 DAL80 Zinc-coordinating ; acc "YKR034W" ; collection "CORE" ; family "GATA" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PB0032.1 10.1361640873387 Irf3 Winged Helix-Turn-Helix ; acc "P70671" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Interferon Regulatory Factor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0199.1 9.08017198664068 Optix Helix-Turn-Helix ; acc "Q95RW8" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PF0020.1 13.0195695082253 GTGACGY Unknown ; MCS "38.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "CREB1" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "E4F1" ; type "phylogenetic" MA0004.1 10.9916749479967 Arnt Zipper-Type ; acc "P53762" ; collection "CORE" ; comment "-" ; family "Helix-Loop-Helix" ; medline "7592839" ; pazar_tf_id "TF0000003" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" PF0137.1 15.6273819419734 GAANYNYGACNY Unknown ; MCS "11.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PF0022.1 13.2772616543157 TGCGCANK Unknown ; MCS "37.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0402.1 11.3557437784715 SWI5 Zinc-coordinating ; acc "YDR146C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PF0002.1 12 CACGTG Unknown ; MCS "85.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "MYC" ; type "phylogenetic" MA0010.1 12.6171586319072 br_Z1 Zinc-coordinating ; acc "Q01295-1" ; collection "CORE" ; comment "Different splice forms affect DNA binding: four matrices" ; family "BetaBetaAlpha-zinc finger" ; medline "8062827" ; pazar_tf_id "TF0000007" ; species "7227" ; tax_group "insects" ; type "COMPILED" POL003.1 11.5380830281189 GC-box Unknown ; Description "The GC-box is recognised by transcription factor Sp1 and typically occurs in housekeeping genes (Kadonaga et al. 1986). " ; End relative to TSS "-157 to +8" ; Start relative to TSS "-170 to -6" ; acc "" ; collection "POLII" ; comment "-" ; medline "2329577" ; species "" MA0279.1 15.6622068499338 CAD1 Zipper-Type ; acc "YDR423C" ; collection "CORE" ; family "Leucine Zipper" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" PH0015.1 14.610038513781 Crx Helix-Turn-Helix ; acc "O54751" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0230.1 11.6941782748841 lab Helix-Turn-Helix ; acc "P10105" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0150.1 14.3935983450542 NFE2L2 Zipper-Type ; acc "Q16236" ; collection "CORE" ; comment "Annotations from PAZAR NFE2L2(NRF2) in the AREs project (TF0000699)." ; family "Leucine Zipper" ; medline "17916232" ; pazar_tf_id "TF0000699" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" MA0013.1 11.6009123934947 br_Z4 Zinc-coordinating ; acc "Q24206" ; collection "CORE" ; comment "Different splice forms affect DNA binding: four matrices" ; family "BetaBetaAlpha-zinc finger" ; medline "8062827" ; pazar_tf_id "TF0000010" ; species "7227" ; tax_group "insects" ; type "COMPILED" CN0213.1 25.3025047912525 LM213 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTTTGAGTTCCTTGGAAGAA" ; medline "17442748" ; species "9606" PB0102.1 10.1413371458925 Zic3 Zinc-coordinating ; acc "Q62521" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0039.1 7.23339319085871 Klf4 Zinc-coordinating ; acc "Q60793" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "9443972" ; pazar_tf_id "TF0000026" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" PB0075.1 14.3898676344356 Sp4 Zinc-coordinating ; acc "Q62445" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0045.1 23.4244082454306 LM45 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GCTAATTGGATTTG" ; medline "17442748" ; species "9606" MA0259.1 9.73982400956926 HIF1A::ARNT Zipper-Type ; acc "EAW80806,EAW53510" ; collection "CORE" ; comment "dimer between HIF1A and ARNT" ; family "Helix-Loop-Helix" ; medline "16234508" ; species "9606,10090,10117,9986" ; tax_group "vertebrates" ; type "COMPILED" CN0102.1 22.3017907010853 LM102 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TCAAAGYACTTTWCAARM" ; medline "17442748" ; species "9606" MA0302.1 9.55934046251425 GAT4 Zinc-coordinating ; acc "YIR013C" ; collection "CORE" ; family "GATA" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PH0108.1 14.450268088113 Msx3 Helix-Turn-Helix ; acc "P70354" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0046.1 14.3841923888905 WTTGKCTG Unknown ; MCS "23.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" CN0008.1 20.9642817346103 LM8 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "MATGAATWATTCATR" ; medline "17442748" ; species "9606" PB0051.1 11.4222358268488 Plagl1 Zinc-coordinating ; acc "O35745" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0085.1 23.5160140257339 LM85 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WKSTTTTCATTAAAGM" ; medline "17442748" ; species "9606" MA0436.1 10.7653362127042 YPR022C Zinc-coordinating ; acc "YPR022C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0213.1 10.9161976221813 brk Helix-Turn-Helix ; acc "Q9XTN4" ; collection "CORE" ; family "Brinker" ; medline "15572468" ; species "7227" ; tax_group "insects" ; type "DNaseI footprinting" MA0108.2 10.0863285219951 TBP Beta-sheet ; acc "" ; collection "CORE" ; comment "column 7 error fixed in version 2 " ; family "TATA box-binding" ; medline "2329577" ; species "" ; tax_group "vertebrates" PF0030.1 15.2846884255224 YGCGYRCGC Unknown ; MCS "30.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PF0081.1 19.6535618616035 CGGAARNGGCNG Unknown ; MCS "15.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0097.1 19.8816971076341 bZIP911 Zipper-Type ; acc "CAA74023" ; collection "CORE" ; comment "-" ; family "Leucine Zipper" ; medline "9680995" ; species "4151" ; tax_group "plants" ; type "SELEX" MA0303.1 13.4778660328311 GCN4 Zipper-Type ; acc "YEL009C" ; collection "CORE" ; family "Leucine Zipper" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" MA0257.1 10.0973916509732 zen2 Helix-Turn-Helix ; acc "P09090" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" POL001.1 20.9565457332953 MTE Unknown ; Description "The matrix is made of 9 sequences that have been tested positively as sites of transcription initiation in vivo." ; End relative to TSS "+33" ; Start relative to TSS "+15" ; acc "" ; collection "POLII" ; comment "-" ; medline "15231738" ; species "7227" MA0096.1 12.5511843642748 bZIP910 Zipper-Type ; acc "CAA74022" ; collection "CORE" ; comment "-" ; family "Leucine Zipper" ; medline "9680995" ; species "4151" ; tax_group "plants" ; type "SELEX" MA0020.1 8.6241100995044 Dof2 Zinc-coordinating ; acc "Q41800" ; collection "CORE" ; comment "-" ; family "Dof" ; medline "10074718" ; species "4577" ; tax_group "plants" ; type "SELEX" MA0381.1 7.95642480202349 SKN7 Winged Helix-Turn-Helix ; acc "YHR206W" ; collection "CORE" ; family "Transcription Factor" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PF0126.1 16.6746705013525 WYAAANNRNNNGCG Unknown ; MCS "11.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" CN0002.1 18.9915557353914 LM2 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "YNRCCACYAGATGGCAGYM" ; medline "17442748" ; species "9606" CN0038.1 23.2143856409627 LM38 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GCAAATTAGCAGCT" ; medline "17442748" ; species "9606" MA0138.2 23.133898399507 REST Zinc-coordinating ; acc "NP_005603" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "17540862 " ; pazar_tf_id "TF0000830" ; species "9606" ; tax_group "vertebrates" ; type "Chip-seq" CN0041.1 21.6262629089616 LM41 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTTTGAAATGCTAATK" ; medline "17442748" ; species "9606" PL0001.1 12.2114602244847 hlh-11 Zipper-type ; acc "P34474" ; collection "PBM_HLH" ; comment "homodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" PB0033.1 13.0235716814011 Irf4 Winged Helix-Turn-Helix ; acc "Q64287" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Interferon Regulatory Factor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0165.1 22.8059318311726 LM165 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GATTTCCTGTTGTG" ; medline "17442748" ; species "9606" PF0115.1 15.9330467030515 YRTCANNRCGC Unknown ; MCS "12.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PH0137.1 14.2397248928712 Pitx1 Helix-Turn-Helix ; acc "P70314" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0197.1 9.51009283285792 Oct Helix-Turn-Helix ; acc "-" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PF0132.1 14.298652112109 TCCATTKW Unknown ; MCS "11.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PH0005.1 13.6408451130939 Barhl1 Helix-Turn-Helix ; acc "P63157" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0005.1 24.1075170284629 LM5 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TCCCATTARYRTTAATGGGA" ; medline "17442748" ; species "9606" PF0165.1 15.9848802580746 CCAWNWWNNNGGC Unknown ; MCS "9.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PH0059.1 12.8262885328954 Hoxb4 Helix-Turn-Helix ; acc "P10284" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0060.1 21.994425588456 LM60 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "YWYATGAATATTCATRWR" ; medline "17442748" ; species "9606" CN0156.1 22.5724021755861 LM156 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "SCTTTGTAAACAAG" ; medline "17442748" ; species "9606" PF0077.1 14.1039821338926 AAAYRNCTG Unknown ; MCS "16.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" CN0225.1 23.388903549835 LM225 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTGTGGAAAATCTGA" ; medline "17442748" ; species "9606" CN0187.1 24.8257961232955 LM187 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTTTGATCTTTCATT" ; medline "17442748" ; species "9606" PH0025.1 12.988854062741 Dmbx1 Helix-Turn-Helix ; acc "Q91ZK4" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0015.1 12 CAGCTG Unknown ; MCS "43.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "NHLH1" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "AP-4" ; type "phylogenetic" CN0198.1 24.3818001742724 LM198 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "MTGAACTTTGTTTGAACT" ; medline "17442748" ; species "9606" PH0013.1 13.3684702495438 Cdx2 Helix-Turn-Helix ; acc "P43241" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0280.1 8.78275239590496 CAT8 Zinc-coordinating ; acc "YMR280C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PH0024.1 10.9140776889322 Dlx5 Helix-Turn-Helix ; acc "P70396" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0383.1 9.33871783570431 SMP1 Other Alpha-Helix ; acc "YBR182C" ; collection "CORE" ; family "MADS Box" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" CN0174.1 23.2717790086553 LM174 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "AGCTGCCAAAAATC" ; medline "17442748" ; species "9606" PF0025.1 13.0232859340055 TGACCTY Unknown ; MCS "33.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "ESRRA" ; type "phylogenetic" PH0120.1 12.4532706753644 Nkx6-3 Helix-Turn-Helix ; acc "Q9D2W8" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0060.1 12.8265429646846 Sox11 Other Alpha-Helix ; acc "Q04889" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0162.1 14.4555832078878 Egr1 Zinc-coordinating ; acc "P08046" ; collection "CORE" ; comment "aka Zif268" ; family "BetaBetaAlpha-zinc finger" ; medline "16041365" ; pazar_tf_id "TF0000345" ; species "10090" ; tax_group "vertebrates" ; type "bacterial 1-hybrid" PB0074.1 9.54729512013954 Sp100 Other Alpha-Helix ; acc "O35892" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Sand" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0145.1 15.0672258374188 Pou2f3 Helix-Turn-Helix ; acc "P31362" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0027.1 6.42106534259983 En1 Helix-Turn-Helix ; acc "P09065" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "8096059" ; pazar_tf_id "TF0000016" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" MA0349.1 10.3358376861698 OPI1 Zipper-Type ; acc "YHL020C" ; collection "CORE" ; family "Leucine Zipper" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" MA0119.1 19.6648726674762 TLX1::NFIC Helix-Turn-Helix::Other ; acc "P31314,NP_995315.1" ; collection "CORE" ; comment "heterodimer between TLX1 and NFIC" ; family "Homeo::Nuclear Factor I-CCAAT-bindingTranscription Factor" ; medline "10327073" ; pazar_tf_id "TF0000083" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" MA0099.1 10.6698488649404 Fos Zipper-Type ; acc "P01101" ; collection "CORE" ; comment "-" ; family "Leucine Zipper" ; medline "2243767" ; pazar_tf_id "TF0000071" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" MA0051.1 21.1344205827808 IRF2 Winged Helix-Turn-Helix ; acc "P14316" ; collection "CORE" ; comment "-" ; family "Interferon Regulatory Factor" ; medline "7687740" ; pazar_tf_id "TF0000033" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" MA0130.1 8.9580088251372 ZNF354C Zinc-coordinating ; acc "Q86Y25" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "15555547" ; pazar_tf_id "TF0000822" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" MA0201.1 12.6373054171588 Ptx1 Helix-Turn-Helix ; acc "O18400" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0081.1 9.06007121381261 SPIB Winged Helix-Turn-Helix ; acc "Q01892" ; collection "CORE" ; comment "-" ; family "Ets" ; medline "7624145" ; pazar_tf_id "TF0000057" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" MA0236.1 10.1240751672098 otp Helix-Turn-Helix ; acc "P56672" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PH0157.1 12.0004438972684 Rhox11_1 Helix-Turn-Helix ; acc "Q810N8" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0081.1 26.3244614080236 LM81 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GGTAATTACATTCTGCYT" ; medline "17442748" ; species "9606" PH0090.1 12.3273781330664 Lbx2 Helix-Turn-Helix ; acc "Q32M12" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0083.1 17.9647716467558 SRF Other Alpha-Helix ; acc "P11831" ; collection "CORE" ; comment "-" ; family "MADS Box" ; medline "2243767" ; pazar_tf_id "TF0000058" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" PH0017.1 10.2334494194658 Cux1_2 Helix-Turn-Helix ; acc "P70403" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" POL006.1 7.65052498791428 BREu Unknown ; Description "Core promoter element that is recognised by TFIIB located uptream of the TATA-box." ; End relative to TSS "-32" ; Start relative to TSS "-39" ; acc "" ; collection "POLII" ; comment "-" ; medline "9420329" ; species "" PF0127.1 14.0839692050207 WWTAAGGC Unknown ; MCS "11.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0254.1 8.16728374802456 vvl Helix-Turn-Helix ; acc "P16241" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "15572468" ; species "7227" ; tax_group "insects" ; type "DNaseI footprinting" PH0012.1 12.8481243816903 Cdx1 Helix-Turn-Helix ; acc "P18111" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0100.1 23.6357721369821 LM100 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "ACTGAGCATGCTCAG" ; medline "17442748" ; species "9606" MF0011.1 5.33180767133444 HMG class HMG ; acc "" ; collection "FAM" ; comment "-" ; included_models "MA0044,MA0045,MA0077,MA0078,MA0084,MA0087" ; medline "15066426" ; species "" ; type "METAMODEL" MA0353.1 16 PDR3 Zinc-coordinating ; acc "YBL005W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" CN0186.1 22.1134208863855 LM186 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GGCAGTAATTTTCC" ; medline "17442748" ; species "9606" PF0166.1 18.1947520491882 YNTTTNNNANGCARM Unknown ; MCS "9.6" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PF0123.1 17.6377292086284 GGCNNMSMYNTTG Unknown ; MCS "11.6" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" CN0040.1 21.8880124085836 LM40 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TCCCATTGACTTCAAWGGGAGYT" ; medline "17442748" ; species "9606" PL0017.1 14.2187702062255 hlh-2::hlh-10 Zipper-type ; acc "Q17588,Q23579" ; collection "PBM_HLH" ; comment "heterodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" MA0313.1 8.22127924740869 HAP2 Other Alpha-Helix ; acc "YGL237C" ; collection "CORE" ; family "NF-Y CCAAT-Binding Protein" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" CN0018.1 23.7515789282212 LM18 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "ATTTGCATNTSATTTGCAT" ; medline "17442748" ; species "9606" PB0014.1 13.2461919125153 Esrra Zinc-coordinating ; acc "O08580" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Hormone-nuclear Receptor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" SD0001.1 8.12219678199792 at_AC_acceptor Unknown ; acc "" ; collection "SPLICE" ; comment "-" ; description "Non-canonical splice acceptor (3') site (at_AC)" ; medline "15475254" ; species "" PB0018.1 15.2680978446124 Foxk1 Winged Helix-Turn-Helix ; acc "P42128" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Forkhead " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0130.1 15.1978017393408 CCCNNGGGAR Unknown ; MCS "11.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "OLF-1" ; type "phylogenetic" PB0048.1 13.0815289826598 Nr2f2 Zinc-coordinating ; acc "P43135" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Hormone-nuclear Receptor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0162.1 15.0714106573294 Six2 Helix-Turn-Helix ; acc "Q62232" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0067.1 14.9798187076105 Hoxc12 Helix-Turn-Helix ; acc "P31313" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0274.1 8.9865976258638 ARR1 Zipper-Type ; acc "YPR199C" ; collection "CORE" ; family "Leucine Zipper" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" PH0071.1 11.1385213378189 Hoxc6 Helix-Turn-Helix ; acc "P10629" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0169.1 23.3541322578337 LM169 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TTCCCAGCTGTTGC" ; medline "17442748" ; species "9606" PH0054.1 10.2241949165341 Hoxa7_1 Helix-Turn-Helix ; acc "P02830" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0011.1 13.6326800080858 Alx1_2 Helix-Turn-Helix ; acc "Q8C8B0" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0039.1 20.8799007782519 LM39 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "KNKGTYTCCTAGGAAACM" ; medline "17442748" ; species "9606" MA0252.1 10.25 vis Helix-Turn-Helix ; acc "A1Z913" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0002.1 11.6956693818896 RUNX1 Ig-fold ; acc "Q01196" ; collection "CORE" ; comment "Matrix changed since last release: removal of primers and sites overlapping primers" ; family "Runt" ; medline "8413232" ; pazar_tf_id "TF0000001" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" MA0090.1 15.6777724709562 TEAD1 Helix-Turn-Helix ; acc "P28347" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "9571041" ; pazar_tf_id "TF0000064" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" PF0092.1 13.0249047188108 TGCTGAY Unknown ; MCS "14.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "MafB" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0141.1 12.8061908151661 Esrrb Zinc-coordinating ; acc "Q61539" ; collection "CORE" ; comment "-" ; family "Hormone-nuclear Receptor" ; medline "18555785 " ; pazar_tf_id "-" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" PF0017.1 12 AACTTT Unknown ; MCS "42.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "NR2F1" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "IRF1(*)" ; type "phylogenetic" PB0056.1 12.2459985391191 Rxra Zinc-coordinating ; acc "P28700" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Hormone-nuclear Receptor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0141.1 16.0536657128652 TTCNRGNNNNTTC Unknown ; MCS "10.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "HSF" ; type "phylogenetic" MA0403.1 8.80299362713321 TBF1 Helix-Turn-Helix ; acc "YPL128C" ; collection "CORE" ; family "Myb" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0040.1 14.0702573602851 Foxq1 Winged Helix-Turn-Helix ; acc "Q63244" ; collection "CORE" ; comment "-" ; family "Forkhead" ; medline "8139574" ; species "10116" ; tax_group "vertebrates" ; type "SELEX" PF0063.1 18.0595027713403 AAGWWRNYGGC Unknown ; MCS "19.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" CN0163.1 23.4620113749556 LM163 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TCATTTCCTCCTAATTGNY" ; medline "17442748" ; species "9606" CN0054.1 21.1215454846814 LM54 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "YMATTCATCACTGTCAR" ; medline "17442748" ; species "9606" MA0228.1 11.3261482141537 ind Helix-Turn-Helix ; acc "O96620" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0221.1 9.31751114395201 eve Helix-Turn-Helix ; acc "P06602" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" CN0221.1 25.6857491206426 LM221 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGGCTGKCTTCCCAG" ; medline "17442748" ; species "9606" MA0118.1 7.46607328520911 Macho-1 Zinc-coordinating ; acc "Q9GRA5" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "15661650" ; species "7729" ; tax_group "urochordates" ; type "SELEX" PH0009.1 11.2328260922271 Bsx Helix-Turn-Helix ; acc "Q810B3" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0262.1 17.2157474927534 mab-3 Zinc-coordinating ; acc "O18214" ; collection "CORE" ; comment "-" ; family "DM" ; medline "9927589" ; species "6239" ; tax_group "nematodes" ; type "EMSA" CN0072.1 24.3845134874948 LM72 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "NATGCYTCATTAAMY" ; medline "17442748" ; species "9606" PH0105.1 13.997803943207 Meis3 Helix-Turn-Helix ; acc "P97368" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0033.1 12.9328767138232 Gbx1 Helix-Turn-Helix ; acc "P82976" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0003.1 11.2173795924231 Ascl2 Zipper-Type ; acc "O35885" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Helix-Loop-Helix " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MF0002.1 10.786011975578 bZIP CREB/G-box-like subclass bZIP ; acc "" ; collection "FAM" ; comment "-" ; included_models "MA0018,MA0089,MA0096,MA0097" ; medline "15066426" ; species "" ; type "METAMODEL" MA0117.1 6.76893921374478 Mafb Zipper-Type ; acc "P54842" ; collection "CORE" ; comment "-" ; family "Leucine Zipper" ; medline "9571165" ; pazar_tf_id "TF0000082" ; species "10116" ; tax_group "vertebrates" ; type "SELEX" PF0156.1 19.114358671457 YRCCAKNNGNCGC Unknown ; MCS "10.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MF0001.1 8.99242242623466 ETS class ETS ; acc "" ; collection "FAM" ; comment "-" ; included_models "MA0026,MA0028,MA0062,MA0076,MA0080,MA0081,MA0098" ; medline "15066426" ; species "" ; type "METAMODEL" CN0207.1 26.4182429717377 LM207 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WKRMYTTTKGCMAAAAKYMA" ; medline "17442748" ; species "9606" MA0268.1 8.4724520365976 ADR1 Zinc-coordinating ; acc "YDR216W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0247.1 12.4251201932675 tin Helix-Turn-Helix ; acc "P22711" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PH0126.1 14.2919356397703 Obox6 Helix-Turn-Helix ; acc "Q8VHG3" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0021.1 14.6093347426636 Gata3 Zinc-coordinating ; acc "P23772" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "GATA " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0124.1 15.5709411286776 Obox5_1 Helix-Turn-Helix ; acc "Q7TPZ5" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0043.1 13.9498796629034 Hmx3 Helix-Turn-Helix ; acc "P42581" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0178.1 20.7181026094443 LM178 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "NNMWTTCATTTTCCAAAGCA" ; medline "17442748" ; species "9606" MA0365.1 11.2870164681831 RFX1 Winged Helix-Turn-Helix ; acc "YLR176C" ; collection "CORE" ; family "RFX" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0326.1 13.2289099435869 MAC1 Zinc-coordinating ; acc "YMR021C" ; collection "CORE" ; family "Copper fist" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" PF0037.1 17.1519912622406 GTTRYCATRR Unknown ; MCS "25.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0105.1 15.6269629573419 NFKB1 Ig-fold ; acc "P19838" ; collection "CORE" ; comment "-" ; family "Rel Homology Region" ; medline "1406630" ; pazar_tf_id "TF0000076" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" MA0123.1 9.74035932391708 abi4 Beta-Hairpin-Ribbon ; acc "Q8L7W9" ; collection "CORE" ; comment "-" ; family "AP2 MBD-like" ; medline "12368505" ; species "4577" ; tax_group "plants" ; type "SELEX" PF0059.1 17.0423594843022 WCTCNATGGY Unknown ; MCS "19.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PH0170.1 15.8860720342715 Tgif2 Helix-Turn-Helix ; acc "Q8C0Y1" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0347.1 14.1918208509896 NRG1 Zinc-coordinating ; acc "YDR043C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" CN0106.1 20.5741289489696 LM106 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGCTGASTCAGCA" ; medline "17442748" ; species "9606" MA0380.1 8.68273371541995 SIP4 Zinc-coordinating ; acc "YJL089W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0088.1 17.5411729665119 znf143 Zinc-coordinating ; acc "Q91853" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "9009278" ; species "8355" ; tax_group "vertebrates" ; type "COMPILED" CN0128.1 25.6746722574165 LM128 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGCCAAGTTTCAGCCTGGAG" ; medline "17442748" ; species "9606" PF0066.1 18.6898753297241 RACTNNRTTTNC Unknown ; MCS "18.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" CN0103.1 20.4275000237908 LM103 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "AAATGTCACCATCTGKW" ; medline "17442748" ; species "9606" CN0012.1 24.883970111514 LM12 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "RTGGCCTGAAAGAGTTAATGCW" ; medline "17442748" ; species "9606" MA0169.1 10.4181530613641 B-H2 Helix-Turn-Helix ; acc "Q24256" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PF0031.1 14.5333591848674 GGGYGTGNY Unknown ; MCS "30.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0396.1 11.1636679090966 STP3 Zinc-coordinating ; acc "YLR375W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PF0004.1 20.622995901164 ACTAYRNNNCCCR Unknown ; MCS "69.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" POL004.1 10.7511552886618 CCAAT-box Unknown ; Description "The CCAAT-box is recognised by the CCAAT-binding proteins NY-I (Dorn et al. 1987), NF-I and C/EBP." ; End relative to TSS "-208 to -52" ; Start relative to TSS "-219 to -64" ; acc "" ; collection "POLII" ; comment "-" ; medline "2329577" ; species "" PH0142.1 13.0467860362069 Pou1f1 Helix-Turn-Helix ; acc "Q00286" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0328.1 14.6254506684601 MATALPHA2 Helix-Turn-Helix ; acc "YCL067C" ; collection "CORE" ; family "Homeo" ; medline "10487868" ; species "4932" ; tax_group "fungi" ; type "COMPILED" MA0048.1 14.1315572207903 NHLH1 Zipper-Type ; acc "Q02575" ; collection "CORE" ; comment "-" ; family "Helix-Loop-Helix" ; medline "8289804" ; pazar_tf_id "TF0000030" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" CN0195.1 23.598578655561 LM195 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TTTCCTTTCCAGCTG" ; medline "17442748" ; species "9606" CN0171.1 22.8012682354102 LM171 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "RTGTTAATGACTTC" ; medline "17442748" ; species "9606" CN0079.1 22.3462482682605 LM79 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TKCWAATGCAAATCAGNY" ; medline "17442748" ; species "9606" PF0012.1 12 CAGGTG Unknown ; MCS "47.6" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "ESR1" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "E12" ; type "phylogenetic" MA0167.1 10.2270602668637 Awh Helix-Turn-Helix ; acc "Q8IRC7" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PF0145.1 14.0417686728717 YKACATTT Unknown ; MCS "10.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0056.1 8.58551320253218 MZF1_1-4 Zinc-coordinating ; acc "P28698" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "8114711" ; pazar_tf_id "TF0000035" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" PB0052.1 13.6364733478738 Rara Zinc-coordinating ; acc "P11416" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Hormone-nuclear Receptor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0080.1 7.21720396462768 SPI1 Winged Helix-Turn-Helix ; acc "P17947" ; collection "CORE" ; comment "-" ; family "Ets" ; medline "7624145" ; pazar_tf_id "TF0000056" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" CN0017.1 22.5463270106005 LM17 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WNWRCATCTGRTTTGCATTW" ; medline "17442748" ; species "9606" MA0421.1 16.3156076910341 YDR026C Helix-Turn-Helix ; acc "YDR026C" ; collection "CORE" ; family "Myb" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" MA0045.1 10.3410853256607 HMG-I/Y Other Alpha-Helix ; acc "CAA61747" ; collection "CORE" ; comment "-" ; family "High Mobility Group (Box)" ; medline "9161031" ; species "3888" ; tax_group "plants" ; type "SELEX" PB0009.1 12.9242390184361 E2F3 Winged Helix-Turn-Helix ; acc "O35261" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Transcription Factor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0100.1 10.4250580029496 Zic1 Zinc-coordinating ; acc "P46684" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0441.1 10.4046340371081 ZMS1 Zinc-coordinating ; acc "YJR127C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PH0087.1 13.8597692919252 Irx6 Helix-Turn-Helix ; acc "Q9ER75" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0018.2 10.1388499313822 CREB1 Zipper-Type ; acc "P16220" ; collection "CORE" ; comment "Annotations from PAZAR CREB1_RAT + CREB1_HUMAN + CREB1_MOUSE in the pleiades genes project (TF0000110, TF0000150, TF0000732)." ; family "Leucine Zipper" ; medline "17916232 " ; pazar_tf_id "TF0000013" ; species "10116,9606,10090" ; tax_group "vertebrates" ; type "COMPILED" PH0155.1 14.4868616184394 Prrx2 Helix-Turn-Helix ; acc "Q06348" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0082.1 19.3265187891226 CTGYNNCTYTAA Unknown ; MCS "15.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PH0143.1 12.0199683536081 Pou2f1 Helix-Turn-Helix ; acc "P25425" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0212.1 11.0269730374724 bcd Helix-Turn-Helix ; acc "P09081" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0182.1 8.66512406989259 CG4328 Helix-Turn-Helix ; acc "Q9VTW3" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0166.1 12.0054460818949 Antp Helix-Turn-Helix ; acc "P02833" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PF0032.1 16.6021012093703 TGASTMAGC Unknown ; MCS "27.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "NF-E2" ; type "phylogenetic" PB0058.1 13.9933320699988 Six6 Helix-Turn-Helix ; acc "Q9QZ28" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0417.1 8.48181774612686 YAP5 Zipper-Type ; acc "YIR018W" ; collection "CORE" ; family "Leucine Zipper" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" CN0010.1 17.756621239845 LM10 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "YKGTTTCCATGGAAACMR" ; medline "17442748" ; species "9606" MA0295.1 11.6026228315199 FHL1 Winged Helix-Turn-Helix ; acc "YPR104C" ; collection "CORE" ; family "Forkhead" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0043.1 11.1469251071435 HLF Zipper-Type ; acc "Q16534" ; collection "CORE" ; comment "-" ; family "Leucine Zipper" ; medline "8065331" ; pazar_tf_id "TF0000028" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" MA0310.1 11.6007920124256 HAC1 Zipper-Type ; acc "YFL031W" ; collection "CORE" ; family "Leucine Zipper" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0256.1 11.737647110429 zen Helix-Turn-Helix ; acc "P09089" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PB0035.1 12.3802307732334 Irf6 Winged Helix-Turn-Helix ; acc "Q8C2Z7" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Interferon Regulatory Factor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0136.1 8.69309549377962 ELF5 Winged Helix-Turn-Helix ; acc "" ; collection "CORE" ; comment "-" ; family "Ets" ; medline "16704374" ; pazar_tf_id "TF0000828" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" PB0055.1 13.4719977651124 Rfxdc2 Winged Helix-Turn-Helix ; acc "Q8CB07" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "RFX " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0047.1 14.6575447950122 Hoxa11 Helix-Turn-Helix ; acc "P31311" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0057.1 23.8882588586762 LM57 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGACAGTAATTAGM" ; medline "17442748" ; species "9606" PF0101.1 13.0798598934366 CTGCAGY Unknown ; MCS "13.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0034.1 9.31133794025198 Gamyb Helix-Turn-Helix ; acc "CAA61021" ; collection "CORE" ; comment "-" ; family "Myb" ; medline "10069063" ; species "4513" ; tax_group "plants" ; type "SELEX" PH0032.1 15.8069622269752 Evx2 Helix-Turn-Helix ; acc "P49749" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0158.1 22.7326934596902 LM158 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "AWGGAAAWCWGWTTTCCWW" ; medline "17442748" ; species "9606" PB0089.1 16.0719644497273 Zbtb12 Zinc-coordinating ; acc "Q6P6L4" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PL0011.1 15.2193340287478 hlh-2::hlh-4 Zipper-type ; acc "Q17588,P34555" ; collection "PBM_HLH" ; comment "heterodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" PB0103.1 14.382464769452 Zscan4 Zinc-coordinating ; acc "XP_145358" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PL0014.1 13.1048253013462 mxl-1::mdl-1 Zipper-type ; acc "P90982,Q21663" ; collection "PBM_HLH" ; comment "heterodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" CN0120.1 23.0445387614172 LM120 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTTAATTACAGGCW" ; medline "17442748" ; species "9606" CN0142.1 25.8247527722756 LM142 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "WNNWNACAGATCATTAACT" ; medline "17442748" ; species "9606" MA0009.1 17.8627489557575 T Beta-Hairpin-Ribbon ; acc "P20293" ; collection "CORE" ; comment "-" ; family "Transcription Factor T" ; medline "8344258" ; pazar_tf_id "TF0000006" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" CN0023.1 18.8800728704782 LM23 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TKACCACCAGGTGGYGCTRW" ; medline "17442748" ; species "9606" PB0061.1 11.3816286063338 Sox12 Other Alpha-Helix ; acc "Q04890" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0296.1 16.2069102545485 FKH1 Winged Helix-Turn-Helix ; acc "YIL131C" ; collection "CORE" ; family "Forkhead" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" PF0169.1 17.751982119229 TTTNNANAGCYR Unknown ; MCS "9.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PB0099.1 11.1827273376085 Zfp740 Zinc-coordinating ; acc "Q6NZQ6" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PB0027.1 8.36273744730006 Gmeb1 Other Alpha-Helix ; acc "Q9JL60" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Sand " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0044.1 8.43180902169531 HMG-1 Other Alpha-Helix ; acc "CAA54168" ; collection "CORE" ; comment "-" ; family "High Mobility Group (Box)" ; medline "9161031" ; species "3888" ; tax_group "plants" ; type "SELEX" PF0139.1 15.5659877857067 AAAYWAACM Unknown ; MCS "11.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "FOXI1" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "HFH-4" ; type "phylogenetic" MA0389.1 8.32597507685772 SRD1 Zinc-coordinating ; acc "YCR018C" ; collection "CORE" ; family "GATA" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PB0087.1 11.6130541793796 Tcfap2e Zipper-Type ; acc "Q6VUP9" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Helix-Loop-Helix " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0208.1 12.9211641016943 al Helix-Turn-Helix ; acc "Q06453" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PF0117.1 16.9753244542901 TGTYNNNNNRGCARM Unknown ; MCS "12.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PB0045.1 11.9458731660375 Mybl1 Helix-Turn-Helix ; acc "P51960" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Myb " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0052.1 16.299797260239 YYCATTCAWW Unknown ; MCS "21.6" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "POU1F1(*)" ; type "phylogenetic" MA0224.1 11.3776904659972 exex Helix-Turn-Helix ; acc "Q9VSC2" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PF0050.1 15.1438737744164 RGAGGAARY Unknown ; MCS "22.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "PU.1" ; type "phylogenetic" PF0051.1 12 TATAAA Unknown ; MCS "22.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "TBP" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "TATA" ; type "phylogenetic" PB0086.1 11.2860722775851 Tcfap2c Zipper-Type ; acc "Q61312" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Helix-Loop-Helix " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0297.1 13.4461023665147 FKH2 Winged Helix-Turn-Helix ; acc "YNL068C" ; collection "CORE" ; family "Forkhead" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PH0062.1 11.9040724861442 Hoxb7 Helix-Turn-Helix ; acc "P09024" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0049.1 13.1419099179088 Hoxa2 Helix-Turn-Helix ; acc "P31245" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0159.1 16.0043149001931 RXR::RAR_DR5 Zinc-coordinating ; acc "P10276,P19793" ; collection "CORE" ; comment "Dimer. Annotations from PAZAR RXR/RAR_HUMAN (TF0000788) in the RARE project." ; family "Hormone-nuclear Receptor" ; medline "17916232" ; pazar_tf_id "TF0000788" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" MA0098.1 7.07782163341167 ETS1 Winged Helix-Turn-Helix ; acc "CAG47050" ; collection "CORE" ; comment "-" ; family "Ets" ; medline "1542566" ; pazar_tf_id "TF0000070" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" PB0097.1 14.9195500318043 Zfp410 Zinc-coordinating ; acc "Q8BKX7" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0158.1 11.8680238554998 Rhox11_2 Helix-Turn-Helix ; acc "Q810N8" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0097.1 13.0614448983193 YATTNATC Unknown ; MCS "13.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "CDP(*)" ; type "phylogenetic" MA0077.1 9.07881462267178 SOX9 Other Alpha-Helix ; acc "P48436" ; collection "CORE" ; comment "-" ; family "High Mobility Group (Box)" ; medline "9973626" ; pazar_tf_id "TF0000053" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" MA0395.1 11.5163123744163 STP2 Zinc-coordinating ; acc "YHR006W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" MA0305.1 10.1503899163061 GCR2 Other ; acc "YNL199C" ; collection "CORE" ; family "Other" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" MA0154.1 11.564474858736 EBF1 Zipper-Type ; acc "Q07802" ; collection "CORE" ; comment "Annotations from PAZAR EBF1_MOUSE (TF0000762) in the Olf_Ebf_TFBS project." ; family "Helix-Loop-Helix" ; medline "17916232" ; pazar_tf_id "TF0000762" ; species "10090" ; tax_group "vertebrates" ; type "COMPILED" MA0267.1 9.51912756205394 ACE2 Zinc-coordinating ; acc "YLR131C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" CN0202.1 22.9993911672978 LM202 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTTGCCAAATGTGAATT" ; medline "17442748" ; species "9606" MA0205.1 7.69842587143543 Trl Zinc-coordinating ; acc "Q08605" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "15572468" ; species "7227" ; tax_group "insects" ; type "DNaseI footprinting" MA0416.1 12.3879218074446 YAP3 Zipper-Type ; acc "YHL009C" ; collection "CORE" ; family "Leucine Zipper" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PF0072.1 14.01182656851 TTCYRGAA Unknown ; MCS "17.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0151.1 9.89631870738828 ARID3A Helix-Turn-Helix ; acc "Q62431" ; collection "CORE" ; comment "Annotations from PAZAR ARID3A_MOUSE in the TFe project (TF0000816)." ; family "Arid" ; medline "8543152" ; pazar_tf_id "TF0000816" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" CN0196.1 24.4372926458252 LM196 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "ATTCATTTTGGCTTTGAAAG" ; medline "17442748" ; species "9606" PH0056.1 12.4299319336993 Hoxa9 Helix-Turn-Helix ; acc "P09631" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0266.1 10.6646221241324 ABF2 Other Alpha-Helix ; acc "YMR072W" ; collection "CORE" ; family "High Mobility Group (Box)" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0339.1 9.02862103383954 MIG3 Zinc-coordinating ; acc "YER028C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0333.1 11.350318795624 MET31 Zinc-coordinating ; acc "YPL038W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0430.1 10.5825139729207 YLR278C Zinc-coordinating ; acc "YLR278C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PH0125.1 15.1138171720684 Obox5_2 Helix-Turn-Helix ; acc "Q7TPZ5" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0049.1 14.0223316971708 CATTGTYY Unknown ; MCS "22.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "SOX9" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "SOX-9" ; type "phylogenetic" PF0099.1 17.6159262597918 ATCMNTCCGY Unknown ; MCS "13.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0293.1 7.49642240276808 ECM23 Zinc-coordinating ; acc "YPL021W" ; collection "CORE" ; family "GATA" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0186.1 11.1809068160911 Dfd Helix-Turn-Helix ; acc "P07548" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PF0061.1 15.0482766179379 YTAATTAA Unknown ; MCS "19.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "LHX3" ; type "phylogenetic" MA0437.1 9.628511594936 YPR196W Zinc-coordinating ; acc "YPR196W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0072.1 17.4248426117905 RORA_2 Zinc-coordinating ; acc "NP_599022" ; collection "CORE" ; comment "isoform type" ; family "Hormone-nuclear Receptor" ; medline "7926749" ; pazar_tf_id "TF0000048" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" MA0394.1 10.5526879446483 STP1 Zinc-coordinating ; acc "YDR463W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" PH0058.1 11.9639844795863 Hoxb3 Helix-Turn-Helix ; acc "P09026" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0194.1 13.187198236074 Lim1 Helix-Turn-Helix ; acc "Q9V472" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0206.1 10.5213421405292 abd-A Helix-Turn-Helix ; acc "P29555" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PH0173.1 14.6098702107201 Uncx Helix-Turn-Helix ; acc "Q78DU3" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0036.1 12.3422728561702 Gsx2 Helix-Turn-Helix ; acc "P31316" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0009.1 14.4006449074309 TGAYRTCA Unknown ; MCS "55.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "ATF3" ; type "phylogenetic" CN0151.1 29.1731745650393 LM151 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "MCCTGAAGCATGARATTTGATTR" ; medline "17442748" ; species "9606" MA0215.1 10.1647648815424 btn Helix-Turn-Helix ; acc "Q9U984" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PF0118.1 17.9681171046028 GGCNRNWCTTYS Unknown ; MCS "12.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PH0165.1 15.1559199114665 Six6_1 Helix-Turn-Helix ; acc "Q9QZ28" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0036.1 24.3913279602104 LM36 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "KGAAAWKNNAWTTYCHW" ; medline "17442748" ; species "9606" PB0063.1 10.8378886546464 Sox14 Other Alpha-Helix ; acc "Q04892" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0179.1 10.7811831829612 CG32532 Helix-Turn-Helix ; acc "Q9VWH1" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PB0101.1 10.2455979309305 Zic2 Zinc-coordinating ; acc "Q62520" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0225.1 11.123180337017 ftz Helix-Turn-Helix ; acc "P02835" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" CN0059.1 20.9838891823972 LM59 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGWCATTTTGACAG" ; medline "17442748" ; species "9606" CN0228.1 24.1029766656565 LM228 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGTTTCATAAAGCTG" ; medline "17442748" ; species "9606" MA0037.1 6.62989113890047 GATA3 Zinc-coordinating ; acc "P23771" ; collection "CORE" ; comment "-" ; family "GATA" ; medline "8321207" ; pazar_tf_id "TF0000024" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" CN0173.1 23.827639429503 LM173 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "ACTGATTTTCCTGACAA" ; medline "17442748" ; species "9606" MA0177.1 10.8076509061582 CG18599 Helix-Turn-Helix ; acc "Q9VEA3" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PF0045.1 18.9552307732213 CCANNAGRKGGC Unknown ; MCS "23.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PH0073.1 11.8880919233097 Hoxc9 Helix-Turn-Helix ; acc "P09633" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0068.1 14.0685007703835 Hoxc13 Helix-Turn-Helix ; acc "P50207" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PF0110.1 16.3343490971089 MCAATNNNNNGCG Unknown ; MCS "12.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PB0093.1 13.6226474234745 Zfp128 Zinc-coordinating ; acc "Q52KP6" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0039.1 13.109562167477 Mnx1 Helix-Turn-Helix ; acc "Q9QZW9" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0106.1 11.9516086179875 Msx1 Helix-Turn-Helix ; acc "P13297" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0031.1 23.4301510765849 LM31 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CTTTTCATCTTCAAAGYRCTTT" ; medline "17442748" ; species "9606" MA0116.1 17.9252482810031 Zfp423 Zinc-coordinating ; acc "O08961" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "9774661" ; pazar_tf_id "TF0000081" ; species "10116" ; tax_group "vertebrates" ; type "SELEX" PB0085.1 12.0421025600468 Tcfap2b Zipper-Type ; acc "Q61313" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Helix-Loop-Helix " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0126.1 9.60193933972294 ovo Zinc-coordinating ; acc "P51521" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "10637336" ; pazar_tf_id "TF0000821" ; species "7227" ; tax_group "insects" ; type "SELEX" MA0438.1 10.64261968031 YRM1 Zinc-coordinating ; acc "YOR172W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PF0027.1 14.42554536176 TGGNNNNNNKCCAR Unknown ; MCS "32.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PF0171.1 15.9617462877539 CTCNANGTGNY Unknown ; MCS "9.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0282.1 11.6351550443192 CEP3 Zinc-coordinating ; acc "YMR168C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0211.1 12.5974217698483 bap Helix-Turn-Helix ; acc "P22809" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0241.1 11.1827921370707 ro Helix-Turn-Helix ; acc "P10181" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0360.1 11.9571542697438 RDR1 Zinc-coordinating ; acc "YOR380W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" CN0211.1 24.8132048190737 LM211 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TGACCTAGAGGTGAAAGGC" ; medline "17442748" ; species "9606" CN0091.1 24.1856242757097 LM91 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "CARCTGTGWAATTG" ; medline "17442748" ; species "9606" MF0006.1 7.89193388107753 bZIP cEBP-like subclass bZIP ; acc "" ; collection "FAM" ; comment "-" ; included_models "MA0019,MA0025,MA0043,MA0102" ; medline "15066426" ; species "" ; type "METAMODEL" POL011.1 16.7194781404227 XCPE1 Unknown ; Description "The matrix is made of the human promoter sequences that are shown in the supplementary material (Table S1). We included only the sites that show XCPE1 activity in vitro." ; End relative to TSS "+2" ; Start relative to TSS "-8" ; acc "" ; collection "POLII" ; comment "-" ; medline "17210644" ; species "" MA0058.1 12.6854143466175 MAX Zipper-Type ; acc "AAH36092" ; collection "CORE" ; comment "-" ; family "Helix-Loop-Helix" ; medline "8265351" ; pazar_tf_id "TF0000037" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" CN0160.1 23.9941793382506 LM160 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "RCTTTCAGAAATSMMWWWW" ; medline "17442748" ; species "9606" MA0356.1 7.44150819522477 PHO2 Helix-Turn-Helix ; acc "YDL106C" ; collection "CORE" ; family "Homeo" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PH0076.1 14.9329524291558 Hoxd11 Helix-Turn-Helix ; acc "P23813" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0044.1 20.6570285246285 LM44 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GTGTAATTGGAAACAGCTG" ; medline "17442748" ; species "9606" MA0074.1 20.4511671987138 RXRA::VDR Zinc-coordinating ; acc "P19793,P11473" ; collection "CORE" ; comment "heterodimer between RXRA and VDR" ; family "Hormone-nuclear Receptor" ; medline "8674817" ; pazar_tf_id "TF0000050" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" PF0122.1 16.8199206715049 RNTCANNRNNYNATTW Unknown ; MCS "11.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" CN0212.1 23.8848573552489 LM212 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "ATGGCTTTCCAAATG" ; medline "17442748" ; species "9606" PH0019.1 10.2386445052527 Dbx2 Helix-Turn-Helix ; acc "Q8BZD0" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0185.1 8.27226975609829 Deaf1 Other Alpha-Helix ; acc "Q24180" ; collection "CORE" ; comment "-" ; family "Sand" ; medline "15572468" ; species "7227" ; tax_group "insects" ; type "DNaseI footprinting" PH0016.1 9.98907329398038 Cux1_1 Helix-Turn-Helix ; acc "P70403" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0423.1 11.403478658641 YER130C Zinc-coordinating ; acc "YER130C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PH0151.1 14.6626797730926 Pou6f1_1 Helix-Turn-Helix ; acc "Q07916" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0143.1 12.9512704531914 Sox2 Other Alpha-Helix ; acc "P48432" ; collection "CORE" ; comment "-" ; family "High Mobility Group (Box)" ; medline "18555785" ; pazar_tf_id "TF0000779" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" MA0101.1 10.514792387777 REL Ig-fold ; acc "Q04864" ; collection "CORE" ; comment "-" ; family "Rel Homology Region" ; medline "1406630" ; pazar_tf_id "TF0000073" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" PF0150.1 17.9010562177425 YTTCCNNNGGAMR Unknown ; MCS "10.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PH0114.1 14.6798948278887 Nkx2-5 Helix-Turn-Helix ; acc "P42582" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" PH0046.1 11.6647251436197 Hoxa10 Helix-Turn-Helix ; acc "P31310" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" CN0130.1 22.3891802519928 LM130 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TCTGATTGGCTGKCR" ; medline "17442748" ; species "9606" MA0411.1 8.68377695225234 UPC2 Zinc-coordinating ; acc "YDR213W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PB0006.1 11.7961228762501 Bcl6b Zinc-coordinating ; acc "O88282" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0039.2 12.6183576805199 Klf4 Zinc-coordinating ; acc "Q60793" ; collection "CORE" ; comment "- " ; family "BetaBetaAlpha-zinc finger" ; medline "18555785 " ; pazar_tf_id "TF0000026" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" CN0004.1 22.9781135839097 LM4 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "RGCMTKCTGGGARTTGTAGTYY" ; medline "17442748" ; species "9606" MA0311.1 9.046501418024 HAL9 Zinc-coordinating ; acc "YOL089C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0112.2 13.5630609490181 ESR1 Zinc-coordinating ; acc "P03372" ; collection "CORE" ; comment "-" ; family "Hormone-nuclear Receptor" ; medline "19339991" ; pazar_tf_id "TF0000189" ; species "9606" ; tax_group "vertebrates" ; type "ChiP-seq" MA0414.1 8.93156487911214 XBP1 Ig-fold ; acc "YIL101C" ; collection "CORE" ; family "Rel Homology Region" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" CN0159.1 23.2126876530612 LM159 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "TTGCTTTGGAAGCAGCT" ; medline "17442748" ; species "9606" MA0317.1 8.82955428161502 HCM1 Winged Helix-Turn-Helix ; acc "YCR065W" ; collection "CORE" ; family "Forkhead" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PF0005.1 13.1207076355866 GATTGGY Unknown ; MCS "64.6" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "NF-Y" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "NF-Y" ; type "phylogenetic" MA0031.1 11.9264176788219 FOXD1 Winged Helix-Turn-Helix ; acc "Q16676" ; collection "CORE" ; comment "-" ; family "Forkhead" ; medline "7957066" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" PF0124.1 15.8840652682399 CCAWYNNGAAR Unknown ; MCS "11.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0284.1 11.4485886306829 CIN5 Zipper-Type ; acc "YOR028C" ; collection "CORE" ; family "Leucine Zipper" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" PF0128.1 16.7895256979172 RYCACNNRNNRNCAG Unknown ; MCS "11.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" PF0160.1 16.9115857648467 CAGNYGKNAAA Unknown ; MCS "9.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" MA0428.1 10.5333189874106 YKL222C Zinc-coordinating ; acc "YKL222C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" MA0229.1 12.4366688007437 inv Helix-Turn-Helix ; acc "P05527" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" MA0017.1 15.9238684526357 NR2F1 Zinc-coordinating ; acc "P10589" ; collection "CORE" ; comment "-" ; family "Hormone-nuclear Receptor" ; medline "8496174" ; pazar_tf_id "TF0000012" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" MA0103.1 8.30486487593768 ZEB1 Zinc-coordinating ; acc "P36197" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "8065305" ; pazar_tf_id "TF0000074" ; species "9031" ; tax_group "vertebrates" ; type "SELEX" CN0227.1 25.4288209025039 LM227 unknown ; acc "" ; collection "CNE" ; comment "-" ; consensus "GAATTTAGTGCTTGTGAAAA" ; medline "17442748" ; species "9606" MA0192.1 11.4976509235011 Hmx Helix-Turn-Helix ; acc "Q9VEI9" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" PB0047.1 13.158095857342 Nkx3-1 Helix-Turn-Helix ; acc "P97436" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" MA0324.1 12.2676275792558 LEU3 Zinc-coordinating ; acc "YLR451W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip"