CN0219.1	24.8607405200657	LM219	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGYKTTGYYWWRGCAAMRCA" ; medline "17442748" ; species "9606" 
CN0217.1	23.7427223366843	LM217	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TTTCATTAGAAGATGAAGCA" ; medline "17442748" ; species "9606" 
CN0076.1	26.6735842900843	LM76	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CCAATTTGCATTTCATTTGC" ; medline "17442748" ; species "9606" 
PH0154.1	14.9612739285114	Prrx1	Helix-Turn-Helix 	; acc "P63013" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0006.1	37.556203116516	LM6	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CAAAGGCTCTTTTMAGAGCCACY" ; medline "17442748" ; species "9606" 
MA0184.1	10.5810878311503	CG9876	Helix-Turn-Helix	; acc "Q7YU61" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PF0114.1	19.0526468210145	YTCCCRNNAGGY	Unknown	; MCS "12.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PH0136.1	14.3629654757121	Phox2b	Helix-Turn-Helix 	; acc "O35690" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0145.1	24.4465940941895	LM145	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "MTWCTCAGATGAAAGRTGCTW" ; medline "17442748" ; species "9606" 
PH0061.1	10.6625925113586	Hoxb6	Helix-Turn-Helix 	; acc "P09023" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0093.1	11.2902795805709	USF1	Zipper-Type	; acc "P22415" ; collection "CORE" ; comment "-" ; family "Helix-Loop-Helix" ; medline "8052536" ; pazar_tf_id "TF0000067" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
CN0069.1	23.3889916959147	LM69	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WGCTAATTRRMTKYYWAWTANM" ; medline "17442748" ; species "9606" 
CN0204.1	24.943067891469	LM204	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTYAAATCCTTTYTGGAA" ; medline "17442748" ; species "9606" 
MA0135.1	16.3541415144804	Lhx3	Helix-Turn-Helix	; acc "P50481" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "11602361" ; pazar_tf_id "TF0000827" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
PF0065.1	17.0077333612805	ARGGGTTAA	Unknown	; MCS "18.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "FXR(*)" ; type "phylogenetic" 
CN0210.1	24.4720016602023	LM210	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TCATYTTGCTTCTGAAAATG" ; medline "17442748" ; species "9606" 
PH0028.1	13.8265342595288	En1	Helix-Turn-Helix 	; acc "P09065" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0364.1	11.5105481084811	REI1	Zinc-coordinating	; acc "YBR267W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
CN0028.1	19.4530351759717	LM28	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "AGAACATCTGTTTCY" ; medline "17442748" ; species "9606" 
PH0038.1	9.72145300606129	Hlx	Helix-Turn-Helix 	; acc "Q61670" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0214.1	23.3936017298117	LM214	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TCTGGAAAAGCACATTTGAT" ; medline "17442748" ; species "9606" 
PH0147.1	13.7538212597244	Pou3f2	Helix-Turn-Helix 	; acc "P31360" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0064.1	24	LM64	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGACAGCTGTTT" ; medline "17442748" ; species "9606" 
MA0107.1	14.7568335646172	RELA	Ig-fold	; acc "Q04206" ; collection "CORE" ; comment "-" ; family "Rel Homology Region" ; medline "1406630" ; pazar_tf_id "TF0000078" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
MA0384.1	17.7314545109442	SNT2	Helix-Turn-Helix	; acc "YGL131C" ; collection "CORE" ; family "Myb" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" 
CN0215.1	23.2712946638551	LM215	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CATTTCTCAGAAATGACT" ; medline "17442748" ; species "9606" 
CN0043.1	20.1931221351829	LM43	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TTGKCAGRAAATGAWW" ; medline "17442748" ; species "9606" 
MA0260.1	10.1225649784196	che-1	Zinc-coordinating	; acc "Q966L8" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "17606643" ; species "6239" ; tax_group "nematodes" ; type "COMPILED" 
PF0093.1	12	GGATTA	Unknown	; MCS "14.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "PITX2" ; type "phylogenetic" 
PF0003.1	14.215601148395	SCGGAAGY	Unknown	; MCS "80.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "ELK4" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "ELK-1" ; type "phylogenetic" 
PF0168.1	14.2775023889509	YTAAYNGCT	Unknown	; MCS "9.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PH0052.1	12.3779848562439	Hoxa5	Helix-Turn-Helix 	; acc "P09021" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0363.1	13.6375665290057	REB1	Helix-Turn-Helix	; acc "YBR049C" ; collection "CORE" ; family "Myb" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PF0142.1	16.1590132663114	ACAWYAAAG	Unknown	; MCS "10.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PH0164.1	13.3437200109299	Six4	Helix-Turn-Helix 	; acc "Q61321" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0092.1	10.1435823386149	Hand1::Tcfe2a	Zipper-Type	; acc "Q64279,P15806" ; collection "CORE" ; comment "-" ; family "Helix-Loop-Helix" ; medline "7791788" ; pazar_tf_id "TF0000066" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
MA0069.1	13.7977195202109	Pax6	Helix-Turn-Helix	; acc "P26367" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "8132558" ; pazar_tf_id "TF0000045" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
PF0089.1	17.2628290239644	GTTNYYNNGGTNA	Unknown	; MCS "14.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PF0034.1	16.8133306424575	CYTAGCAAY	Unknown	; MCS "26.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0373.1	11.7282809534733	RPN4	Zinc-coordinating	; acc "YDL020C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PF0136.1	14.2994433643608	TAAYNRNNTCC	Unknown	; MCS "11.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PH0150.1	15.0411514730562	Pou4f3	Helix-Turn-Helix 	; acc "P63955" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0010.1	16.25583700188	GCCATNTTG	Unknown	; MCS "54.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "YY1" ; type "phylogenetic" 
MA0190.1	10.7593294683233	Gsc	Helix-Turn-Helix	; acc "P54366" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
CN0135.1	25.2610814423723	LM135	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "ACCCTRGTGGCCTGAAAGAG" ; medline "17442748" ; species "9606" 
PB0069.1	10.7463021274099	Sox30	Other Alpha-Helix	; acc "Q8CGW4" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box)" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0042.1	14.3903995929035	Hmx2	Helix-Turn-Helix 	; acc "P43687" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0062.1	11.5212191776261	Sox13	Other Alpha-Helix 	; acc "Q04891" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0144.1	14.5845040380284	Pou2f2	Helix-Turn-Helix 	; acc "Q00196" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0235.1	11.5288165079441	onecut	Helix-Turn-Helix	; acc "Q9NJB5" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0375.1	10.0563845774726	RSC30	Zinc-coordinating	; acc "YHR056C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PH0079.1	11.5984025624189	Hoxd3	Helix-Turn-Helix 	; acc "P09027" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0125.1	24.0240531513715	LM125	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GCTAATTRCAAATSA" ; medline "17442748" ; species "9606" 
MA0244.1	8.18009882562683	slbo	Zinc-coordinating	; acc "Q02637" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "15572468" ; species "7227" ; tax_group "insects" ; type "DNaseI footprinting" 
MA0216.1	8.85310453247852	cad	Helix-Turn-Helix	; acc "P09085" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0407.1	21.6304825814125	THI2	Zinc-coordinating	; acc "YBR240C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" 
MA0144.1	13.6006725893023	Stat3	Ig-fold	; acc "P42227" ; collection "CORE" ; comment "-" ; family "Stat Protein" ; medline "18555785 " ; pazar_tf_id "TF0000492" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" 
PF0056.1	14.4281531120845	GGGTGGRR	Unknown	; MCS "20.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "PAX-4" ; type "phylogenetic" 
MA0370.1	9.90037292689634	RME1	Zinc-coordinating	; acc "YGR044C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
MA0404.1	9.83381455420407	TBS1	Zinc-coordinating	; acc "YBR150C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PH0021.1	11.5011973263549	Dlx2	Helix-Turn-Helix 	; acc "P40764" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0054.1	16.4877864484419	TAAWWATAG	Unknown	; MCS "21.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "RSRFC4" ; type "phylogenetic" 
PF0060.1	12	TTGTTT	Unknown	; MCS "19.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "FOXF2" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "FOXO4" ; type "phylogenetic" 
PH0099.1	12.9428653716421	Lhx9	Helix-Turn-Helix 	; acc "Q9WUH2" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0337.1	9.14421097975959	MIG1	Zinc-coordinating	; acc "YGL035C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0086.1	10.7055726786483	sna	Zinc-coordinating	; acc "P08044" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "8371971" ; pazar_tf_id "TF0000061" ; species "7227" ; tax_group "insects" ; type "SELEX" 
PH0081.1	12.1988830956743	Pdx1	Helix-Turn-Helix 	; acc "P52946" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0064.1	10.6221901518379	Sox15	Other Alpha-Helix 	; acc "P43267" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0424.1	9.24952409497998	YER184C	Zinc-coordinating	; acc "YER184C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0397.1	11.6860308813466	STP4	Zinc-coordinating	; acc "YDL048C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PF0048.1	17.335559283646	GCGNNANTTCC	Unknown	; MCS "22.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "C-REL(*)" ; type "phylogenetic" 
PF0090.1	15.6763883525985	YAATNRNNNYNATT	Unknown	; MCS "14.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "CART-1(*)" ; type "phylogenetic" 
MA0171.1	10.8915694711545	CG11085	Helix-Turn-Helix	; acc "Q9VYL0" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
CN0137.1	23.4214435483514	LM137	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WNRRAGBAATTTGGCAGCW" ; medline "17442748" ; species "9606" 
CN0131.1	27.4002809055401	LM131	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TCCAAYTTGGATAATTGCAT" ; medline "17442748" ; species "9606" 
MA0149.1	32.8714828380974	EWSR1-FLI1	Winged Helix-Turn-Helix	; acc "Q9BZD1" ; collection "CORE" ; comment "fusion protein between EWSR1 and FLI1 in an oncogenic event." ; family "Ets" ; medline "19305498" ; pazar_tf_id "TF0000660" ; species "9606" ; tax_group "vertebrates" ; type "ChiP-seq" 
MA0294.1	11.1985903414279	EDS1	Zinc-coordinating	; acc "YBR033W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0288.1	10.8309268827297	CUP9	Helix-Turn-Helix	; acc "YPL177C" ; collection "CORE" ; family "Homeo" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PH0167.1	11.4884204897329	Tcf1	Helix-Turn-Helix 	; acc "Q66JY7" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0172.1	11.5176777923711	Tlx2	Helix-Turn-Helix 	; acc "Q61663" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0248.1	9.38705335288453	tup	Helix-Turn-Helix	; acc "Q9VJ37" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PL0013.1	12.0736403311657	hlh-2::hlh-15	Zipper-type	; acc "Q17588,Q18590" ; collection "PBM_HLH" ; comment "heterodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" 
PH0006.1	15.5011632450799	Barhl2	Helix-Turn-Helix 	; acc "Q8VIB5" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0062.2	13.3349242365611	GABPA	Winged Helix-Turn-Helix	; acc "Q91YY8" ; collection "CORE" ; comment "-" ; family "Ets" ; medline "19160518  " ; pazar_tf_id "TF0000039" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" 
PF0119.1	16.7523948696153	GGGNRMNNYCAT	Unknown	; MCS "11.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0406.1	10.7605806772712	TEC1	Helix-Turn-Helix	; acc "YBR083W" ; collection "CORE" ; family "Homeo" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0323.1	20.6227955935036	IXR1	Other Alpha-Helix	; acc "YKL032C" ; collection "CORE" ; family "High Mobility Group (Box)" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
MA0382.1	14.5714790885251	SKO1	Zipper-Type	; acc "YNL167C" ; collection "CORE" ; family "Leucine Zipper" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" 
MA0079.2	11.1288626921664	SP1	Zinc-coordinating	; acc "P08047" ; collection "CORE" ; comment "Annotations from PAZAR SP1 + SP1_MOUSE + SP1_HUMAN + SP1_RAT in the pleiades genes project (TF0000105, TF0000121, TF0000137, TF0000146)." ; family "BetaBetaAlpha-zinc finger" ; medline "17916232" ; pazar_tf_id "TF0000055" ; species "9606,10090,10116" ; tax_group "vertebrates" ; type "COMPILED" 
PB0007.1	13.7408970260716	Bhlhb2	Zipper-Type 	; acc "O35185" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Helix-Loop-Helix " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0094.1	24.8567798112583	LM94	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WRGMAAATTSAATTTKCMWWW" ; medline "17442748" ; species "9606" 
MF0009.1	6.40223313941086	TRP(MYB) class	TRP	; acc "" ; collection "FAM" ; comment "-" ; included_models " MA0034,MA0050,MA0051,MA0054,MA0100" ; medline "15066426" ; species "" ; type "METAMODEL" 
PF0070.1	13.0053062046387	CGTSACG	Unknown	; MCS "17.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "PAX-3" ; type "phylogenetic" 
MA0283.1	11.2361685710842	CHA4	Zinc-coordinating	; acc "YLR098C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
CN0058.1	23.4925658167972	LM58	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CATAAATCACAGCTKH" ; medline "17442748" ; species "9606" 
MA0023.1	14.1230520913631	dl_2	Ig-fold	; acc "P15330" ; collection "CORE" ; comment "dl has a dual binding specificity and therefore two models: MA0022 and MA0023" ; family "Rel Homology Region" ; medline "1582412" ; species "7227" ; tax_group "insects" ; type "SELEX" 
MA0054.1	8.56143865224759	myb.Ph3	Helix-Turn-Helix	; acc "Q02994" ; collection "CORE" ; comment "-" ; family "Myb" ; medline "7737128" ; species "4102" ; tax_group "plants" ; type "SELEX" 
MA0355.1	8.02076073548503	PHD1	Other	; acc "YKL043W" ; collection "CORE" ; family "KilA-N" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PH0153.1	14.1165172767094	Prop1	Helix-Turn-Helix 	; acc "P97458" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0065.2	11.6630620376181	PPARG::RXRA	Zinc-coordinating	; acc "P37238,P28700" ; collection "CORE" ; comment "Heterodimer between PPARG and RXRA" ; family "Hormone-nuclear Receptor" ; medline "18981474" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" 
CN0201.1	23.3636148924881	LM201	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTTTCAAAGGCTCATTA" ; medline "17442748" ; species "9606" 
CN0233.1	24.3505370585227	LM233	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGTTGATTCTTTCCAGGAAA" ; medline "17442748" ; species "9606" 
MA0348.1	10.3464401067094	OAF1	Zinc-coordinating	; acc "YAL051W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PB0030.1	12.6224128627095	Hnf4a	Zinc-coordinating 	; acc "P49698" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Hormone-nuclear Receptor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0314.1	15.5165249852544	HAP3	Other Alpha-Helix	; acc "YBL021C" ; collection "CORE" ; family "NF-Y CCAAT-Binding Protein" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" 
CN0003.1	21.3718399470909	LM3	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "KGTTGCTWRGCAACM" ; medline "17442748" ; species "9606" 
PL0010.1	10.3437692505246	hlh-2::hlh-19	Zipper-type	; acc "Q17588,Q20941" ; collection "PBM_HLH" ; comment "heterodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" 
CN0149.1	23.4669238548993	LM149	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TTGCTTTCAAATGCCAGGA" ; medline "17442748" ; species "9606" 
MA0372.1	11.754351535133	RPH1	Zinc-coordinating	; acc "YER169W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
SD0002.1	12.3393140803366	at_AC_acceptor	Unknown	; acc "" ; collection "SPLICE" ; comment "-" ; description "Non-canonical splice acceptor (3') site (at_AC)" ; medline "15475254" ; species "" 
CN0066.1	23.136319024744	LM66	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GAATGATTAATGACY" ; medline "17442748" ; species "9606" 
MA0227.1	10.4094093488699	hth	Helix-Turn-Helix	; acc "O46339" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0400.1	14.5151426884582	SUT2	Zinc-coordinating	; acc "YPR009W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
MA0033.1	6.06853671151551	FOXL1	Winged Helix-Turn-Helix	; acc "Q12952" ; collection "CORE" ; comment "-" ; family "Forkhead" ; medline "7957066" ; pazar_tf_id "TF0000021" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
CN0046.1	20.0283693584513	LM46	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "ARCAGCTGTTSAAA" ; medline "17442748" ; species "9606" 
MA0218.1	8.34436833001639	ct	Helix-Turn-Helix	; acc "P10180" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MF0010.1	6.07722094833639	Homeobox class	Homeo	; acc "" ; collection "FAM" ; comment "-" ; included_models "MA0008,MA0027,MA0046,MA0063,MA0068,MA0070,MA0075,MA0094" ; medline "15066426" ; species "" ; type "METAMODEL" 
MA0094.2	11.7880868265221	Ubx	Helix-Turn-Helix	; acc "P83949" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PH0002.1	13.4895446303888	Alx4	Helix-Turn-Helix 	; acc "O35137" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PL0008.1	13.0469439689207	hlh-29	Zipper-type	; acc "Q19917" ; collection "PBM_HLH" ; comment "homodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" 
PH0031.1	13.1363164187002	Evx1	Helix-Turn-Helix 	; acc "P23683" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0174.1	13.0048977287358	WTGAAAT	Unknown	; MCS "8.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PF0084.1	17.0715221408565	RGTTAMWNATT	Unknown	; MCS "15.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "HNF-1" ; type "phylogenetic" 
MA0011.1	7.72345967810759	br_Z2	Zinc-coordinating	; acc "Q01295-4" ; collection "CORE" ; comment "Different splice forms affect DNA binding: four matrices" ; family "BetaBetaAlpha-zinc finger" ; medline "8062827" ; pazar_tf_id "TF0000008" ; species "7227" ; tax_group "insects" ; type "COMPILED" 
CN0218.1	23.7930395929081	LM218	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GAAAATGGGCTGTTT" ; medline "17442748" ; species "9606" 
PH0141.1	14.7260532450314	Pknox2	Helix-Turn-Helix 	; acc "Q8BG99" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0105.1	23.0217440403128	LM105	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTCCCATTGACTTCAATGG" ; medline "17442748" ; species "9606" 
PB0072.1	12.5147507126017	Sox7	Other Alpha-Helix 	; acc "P40646" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0240.1	11.3907481048057	repo	Helix-Turn-Helix	; acc "Q24477" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PH0084.1	13.3814243192356	Irx3_2	Helix-Turn-Helix 	; acc "P81067" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0024.1	12.2463344586544	Gcm1	Zinc-coordinating 	; acc "P70348" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Glial Cells Missing (GCM)  " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0095.1	15.0748333637152	GCCNNNWTAAR	Unknown	; MCS "13.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PH0066.1	14.6116506538805	Hoxc11	Helix-Turn-Helix 	; acc "P31312" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0413.1	15.8624146130698	USV1	Zinc-coordinating	; acc "YPL230W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
PB0026.1	14.7249194770805	Zscan4c	Zinc-coordinating	; acc "Q3URS2" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MF0005.1	10.3094355478249	Forkhead class	Forkhead	; acc "" ; collection "FAM" ; comment "-" ; included_models "MA0030,MA0031,MA0032,MA0033,MA0040,MA0041,MA0042,MA0047" ; medline "15066426" ; species "" ; type "METAMODEL" 
MA0147.1	11.1572392768441	Myc	Zipper-Type	; acc "P01108" ; collection "CORE" ; comment "-" ; family "Helix-Loop-Helix" ; medline "18555785" ; pazar_tf_id "TF0000420" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" 
CN0222.1	23.9969912530281	LM222	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TTGGAAAGACTTCAAAGA" ; medline "17442748" ; species "9606" 
MA0005.1	9.09439842911724	AG	Other Alpha-Helix	; acc "P17839" ; collection "CORE" ; comment "dimer" ; family "MADS Box" ; medline "7901838" ; species "3702" ; tax_group "plants" ; type "SELEX" 
MA0089.1	7.9381437011596	NFE2L1::MafG	Zipper-Type	; acc "Q14494,Q90889" ; collection "CORE" ; comment "Heterodimer between TCF11 and Mafg" ; family "Leucine Zipper" ; medline "9421508" ; pazar_tf_id "TF0000063" ; species "9031" ; tax_group "vertebrates" ; type "SELEX" 
MA0410.1	11.0215048954627	UGA3	Zinc-coordinating	; acc "YDL170W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
CN0134.1	24.189676919438	LM134	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTTAATTAGCTGWA" ; medline "17442748" ; species "9606" 
MA0377.1	10.9537317683742	SFL1	Winged Helix-Turn-Helix	; acc "YOR140W" ; collection "CORE" ; family "Transcription Factor" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
PH0041.1	13.5993100628548	Hmx1	Helix-Turn-Helix 	; acc "O70218" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0122.1	15.3812409727179	Obox2	Helix-Turn-Helix 	; acc "Q8VHG7" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0166.1	23.0591356107137	LM166	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CATGCTGAGATCAA" ; medline "17442748" ; species "9606" 
PH0026.1	15.2510940926398	Duxbl	Helix-Turn-Helix 	; acc "Q3UY88" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0012.1	9.33723168511452	br_Z3	Zinc-coordinating	; acc "Q01295-2" ; collection "CORE" ; comment "Different splice forms affect DNA binding: four matrices" ; family "BetaBetaAlpha-zinc finger" ; medline "8062827" ; pazar_tf_id "TF0000009" ; species "7227" ; tax_group "insects" ; type "COMPILED" 
PB0010.1	14.3249921578497	Egr1	Zinc-coordinating 	; acc "P08046" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PL0016.1	14.7939049583701	ref-1	Zipper-type	; acc "Q22069" ; collection "PBM_HLH" ; comment "homodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" 
PB0001.1	9.18274815201174	Arid3a	Helix-Turn-Helix 	; acc "Q62431" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Arid  " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0139.1	15.1882530235194	Pitx3	Helix-Turn-Helix 	; acc "O35160" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0104.1	15.3137725885187	Meis2	Helix-Turn-Helix 	; acc "P97367" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0132.1	9.03956138518612	Pdx1	Helix-Turn-Helix	; acc "NP_032840" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "14704343" ; pazar_tf_id "TF0000824" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
CN0075.1	23.1321356507585	LM75	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CAATTTGCAATTCADW" ; medline "17442748" ; species "9606" 
MA0316.1	13.3921040128677	HAP5	Other Alpha-Helix	; acc "YOR358W" ; collection "CORE" ; family "NF-Y CCAAT-Binding Protein" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" 
CN0022.1	21.7771243115557	LM22	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CAGCTGTTWAACAGCTG" ; medline "17442748" ; species "9606" 
PB0013.1	13.7959993558201	Eomes	Beta-Hairpin-Ribbon 	; acc "O54839" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Transcription Factor T" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0110.1	26.2951091725639	LM110	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "ATTTCCTGGGGATTAATGACY" ; medline "17442748" ; species "9606" 
PF0043.1	19.9420272952388	GTTGNYNNRGNAAC	Unknown	; MCS "23.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0249.1	10.0176678436754	twi	Zipper-type	; acc "P10627" ; collection "CORE" ; comment "-" ; family "Helix-Loop-Helix" ; medline "15572468" ; species "7227" ; tax_group "insects" ; type "DNaseI footprinting" 
PB0036.1	13.9365646125054	Irf9	Winged Helix-Turn-Helix 	; acc "Q61179" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Interferon Regulatory Factor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0127.1	23.2419762025656	LM127	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TTTTGACAGCTCAG" ; medline "17442748" ; species "9606" 
PH0078.1	12.8762880483715	Hoxd13	Helix-Turn-Helix 	; acc "P70217" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0277.1	11.5250621621078	AZF1	Zinc-coordinating	; acc "YOR113W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0427.1	7.92978162553499	YJL103C	Zinc-coordinating	; acc "YJL103C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
CN0164.1	23.8746324163003	LM164	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TTGAAATGAAATGTGAC" ; medline "17442748" ; species "9606" 
MA0035.1	5.73662622978588	Gata1	Zinc-coordinating	; acc "P17679" ; collection "CORE" ; comment "-" ; family "GATA" ; medline "8321207" ; pazar_tf_id "TF0000022" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
PH0101.1	14.5902929450055	Lmx1b	Helix-Turn-Helix 	; acc "O88609" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0255.1	8.72334582131037	z	Helix-Turn-Helix	; acc "P09956" ; collection "CORE" ; comment "-" ; family "Zeste" ; medline "15572468" ; species "7227" ; tax_group "insects" ; type "DNaseI footprinting" 
MA0066.1	20.3650558402138	PPARG	Zinc-coordinating	; acc "P37231" ; collection "CORE" ; comment "-" ; family "Hormone-nuclear Receptor" ; medline "11139380" ; pazar_tf_id "TF0000042" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
MA0111.1	11.9065419262377	Spz1	Other	; acc "AAK15458" ; collection "CORE" ; comment "-" ; family "Other" ; medline "11165476" ; pazar_tf_id "TF0000079" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
MA0320.1	13.8307828297108	IME1	Other	; acc "YJR094C" ; collection "CORE" ; family "Other" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
MA0366.1	8.99230242469699	RGM1	Zinc-coordinating	; acc "YMR182C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
CN0027.1	23.8959198763857	LM27	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "ATTTGCATSTCATTWGCA" ; medline "17442748" ; species "9606" 
PH0148.1	14.1392509280878	Pou3f3	Helix-Turn-Helix 	; acc "P31361" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0050.1	14.0803579444063	Osr2	Zinc-coordinating 	; acc "Q91ZD1" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0028.1	8.81228541287854	ELK1	Winged Helix-Turn-Helix	; acc "P19419" ; collection "CORE" ; comment "-" ; family "Ets" ; medline "1425594" ; pazar_tf_id "TF0000017" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
CN0184.1	22.8604735660693	LM184	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTGCCCTTGATTTG" ; medline "17442748" ; species "9606" 
PF0047.1	13.0000101566652	TGCCAAR	Unknown	; MCS "22.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "Hox11-CTF1" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "NF-1" ; type "phylogenetic" 
MA0139.1	17.205108119684	CTCF	Zinc-coordinating 	; acc "P49711" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "17512414 " ; pazar_tf_id "TF0000607" ; species "9606" ; tax_group "vertebrates" ; type "ChiP-seq" 
CN0052.1	28.0018706101454	LM52	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "RYVTAATTAGGAAGGTAAATM" ; medline "17442748" ; species "9606" 
PF0068.1	13.0493301441172	RGAANNTTC	Unknown	; MCS "17.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "HSF1" ; type "phylogenetic" 
PF0108.1	15.8580414595794	AACWWCAANK	Unknown	; MCS "12.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "FAC1(*)" ; type "phylogenetic" 
PH0001.1	14.5219080640989	Alx3	Helix-Turn-Helix 	; acc "O70137" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0048.1	23.3249924223388	LM48	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "YTAATGAGCTCATTAR" ; medline "17442748" ; species "9606" 
MA0108.1	10.1980738528127	TBP	Beta-sheet	; acc "" ; collection "CORE" ; comment "-" ; family "TATA box-binding" ; medline "2329577" ; species "" ; tax_group "vertebrates" 
PH0085.1	11.9055286760663	Irx4	Helix-Turn-Helix 	; acc "Q9QY61" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0038.1	9.47016680639999	Gfi	Zinc-coordinating	; acc "Q07120" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "8754800" ; pazar_tf_id "TF0000025" ; species "10116" ; tax_group "vertebrates" ; type "SELEX" 
MA0125.1	9.57325017965508	Nobox	Helix-Turn-Helix	; acc "Q8VIH1" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "16997917" ; pazar_tf_id "TF0000820" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
PH0097.1	12.7008101306894	Lhx6_2	Helix-Turn-Helix 	; acc "Q9R1R0" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0138.1	22.9583305401171	REST	Zinc-coordinating	; acc "NP_005603" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "-" ; pazar_tf_id "TF0000830" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" 
CN0180.1	23.8116243822919	LM180	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "KWTTTCATTTGAATGCT" ; medline "17442748" ; species "9606" 
MA0362.1	10.1804339621107	RDS2	Zinc-coordinating	; acc "YPL133C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0120.1	7.72439203551961	id1	Zinc-coordinating	; acc "AAC18941" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "15020707" ; species "4577" ; tax_group "plants" ; type "SELEX" 
MA0015.1	10.9770931714416	Cf2_II	Zinc-coordinating	; acc "P20385" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "1290524" ; species "7227" ; tax_group "insects" ; type "SELEX" 
MA0129.1	9.7969611783168	TGA1A	Zipper-Type	; acc "CAA34468" ; collection "CORE" ; comment "-" ; family "Leucine Zipper" ; medline "10561063" ; species "4094" ; tax_group "plants" ; type "SELEX" 
PF0167.1	15.7543754111121	CCTNTMAGA	Unknown	; MCS "9.6" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0272.1	11.6555557488392	ARG81	Zinc-coordinating	; acc "YML099C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
CN0062.1	20.1946152010481	LM62	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "AATTGCTTCCAGATG" ; medline "17442748" ; species "9606" 
PH0088.1	11.4214764551471	Isl2	Helix-Turn-Helix 	; acc "Q9CXV0" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0124.1	22.5881500368539	LM124	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "YTGCCAAATGGAAAW" ; medline "17442748" ; species "9606" 
MF0007.1	7.72446306243099	bHLH(zip) class	bHLH(zip)	; acc "" ; collection "FAM" ; comment "-" ; included_models "MA0004,MA0006,MA0048,MA0055,MA0058, MA0059,MA0091,MA0092,MA0093,MA0104" ; medline "15066426" ; species "" ; type "METAMODEL" 
MA0055.1	15.9141418791189	Myf	Zipper-Type	; acc "" ; collection "CORE" ; comment "-" ; family "Helix-Loop-Helix" ; medline "9571041" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" 
MA0357.1	11.0029849196491	PHO4	Zipper-Type	; acc "YFR034C" ; collection "CORE" ; family "Helix-Loop-Helix" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
CN0037.1	23.0541404787858	LM37	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "YATGCAAATGAGCCM" ; medline "17442748" ; species "9606" 
PH0082.1	13.792043665802	Irx2	Helix-Turn-Helix 	; acc "P81066" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0175.1	22.7565022477221	LM175	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTGTTGACAGTAAA" ; medline "17442748" ; species "9606" 
MA0330.1	9.81950176103914	MBP1::SWI6	Ig-fold	; acc "YDL056W" ; collection "CORE" ; family "Rel Homology Region" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" 
MA0275.1	9.09626563225961	ASG1	Zinc-coordinating	; acc "YIL130W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0099.2	9.19332543812042	AP1	Zipper-Type	; acc "P05412,P01100" ; collection "CORE" ; comment "Dimer. Annotations from PAZAR C-JUN + JUN_RAT + JUN_MOUSE + JUN_HUMAN + FOS/JUN_HUMAN + FOS_HUMAN in the pleiades genes project (TF0000129, TF0000147, TF0000234, TF0000243, TF0000670, TF0000287)." ; family "Leucine Zipper" ; medline "17916232" ; pazar_tf_id "TF0000071" ; species "9606,10116,10090" ; tax_group "vertebrates" ; type "COMPILED" 
CN0016.1	23.3132593748501	LM16	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTTTGARATCCTYAGATGAAAGR" ; medline "17442748" ; species "9606" 
PH0020.1	12.1294020195637	Dlx1	Helix-Turn-Helix 	; acc "Q64317" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0113.1	25.7958286123747	LM113	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WYTGTTTTKCTTGGCA" ; medline "17442748" ; species "9606" 
MA0434.1	10.8489060465005	YPR013C	Zinc-coordinating	; acc "YPR013C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
CN0183.1	22.8347988531333	LM183	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "AGCTGTCATTCTTGGAA" ; medline "17442748" ; species "9606" 
CN0112.1	24.5271536804108	LM112	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTCATTTGCATATTC" ; medline "17442748" ; species "9606" 
CN0029.1	23.5017994831121	LM29	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WGCTAATTGCAAATG" ; medline "17442748" ; species "9606" 
POL007.1	1.31756354163441	BREd	Unknown	; Description "Core promoter element that is recognised by TFIIB located downstream of the TATA-box." ; End relative to TSS "-17 " ; Start relative to TSS "-23" ; acc "" ; collection "POLII" ; comment "-" ; medline "16230532 " ; species "" 
MA0085.1	16.6733068362852	Su(H)	Other	; acc "P28159" ; collection "CORE" ; comment "-" ; family "DNA-binding LAG-1-like" ; medline "7590239" ; pazar_tf_id "TF0000060" ; species "7227" ; tax_group "insects" ; type "COMPILED" 
PB0083.1	13.4701618065623	Tcf7l2	Other Alpha-Helix 	; acc "Q924A0" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0174.1	11.7018548491893	Vax1	Helix-Turn-Helix 	; acc "Q2NKI2" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0378.1	12.5288363150423	SFP1	Zinc-coordinating	; acc "YLR403W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
MA0265.1	11.7446627847401	ABF1	Zinc-coordinating	; acc "YKL112W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
CN0013.1	26	LM13	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WTGCTAATTAGCA" ; medline "17442748" ; species "9606" 
MA0319.1	10.0936537569331	HSF1	Winged Helix-Turn-Helix	; acc "YGL073W" ; collection "CORE" ; family "Transcription Factor" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0340.1	9.41503749927884	MOT3	Zinc-coordinating	; acc "YMR070W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
CN0168.1	22.4792810838903	LM168	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GCTTGTCAGAAACA" ; medline "17442748" ; species "9606" 
PH0169.1	14.642545401328	Tgif1	Helix-Turn-Helix 	; acc "" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0146.1	14.2106260290607	Pou3f1	Helix-Turn-Helix 	; acc "P21952" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0087.1	10.8307137071314	Sox5	Other Alpha-Helix	; acc "P35710" ; collection "CORE" ; comment "-" ; family "High Mobility Group (Box)" ; medline "1396566" ; pazar_tf_id "TF0000062" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
CN0099.1	22.4431552384205	LM99	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "DSAGGAAATGACTCA" ; medline "17442748" ; species "9606" 
CN0053.1	21.690876286111	LM53	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TCATTTGCATTKCAAAT" ; medline "17442748" ; species "9606" 
MA0174.1	9.40538072901653	CG42234	Helix-Turn-Helix	; acc "Q9W064" ; collection "CORE" ; comment "formerly CG12361" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PF0121.1	16.4054352247606	CCAWWNAAGG	Unknown	; MCS "11.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "SRF" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "SRF" ; type "phylogenetic" 
CN0095.1	23.5439864925077	LM95	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "YTGCTCTSTAATTAG" ; medline "17442748" ; species "9606" 
PB0017.1	13.3108011429449	Foxj3	Winged Helix-Turn-Helix 	; acc "Q8BUR3" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Forkhead  " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0072.1	11.4853919531975	Hoxc8	Helix-Turn-Helix 	; acc "P09025" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0155.1	14.8617070293245	INSM1	Zinc-coordinating	; acc "Q01101" ; collection "CORE" ; comment "Annotations from PAZAR INSM1_HUMAN (TF0000773) in the TFe project." ; family "BetaBetaAlpha-zinc finger" ; medline "17916232" ; pazar_tf_id "TF0000773" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" 
PH0112.1	13.1908433830521	Nkx2-3	Helix-Turn-Helix 	; acc "P97334" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0062.1	13.8895030261926	GABPA	Winged Helix-Turn-Helix	; acc "Q06546" ; collection "CORE" ; comment "-" ; family "Ets" ; medline "8383622" ; pazar_tf_id "TF0000039" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" 
PH0128.1	15.4750252843271	Otp	Helix-Turn-Helix 	; acc "O09113" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0083.1	24.8026372819834	LM83	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTGTCAAAATCAAT" ; medline "17442748" ; species "9606" 
MA0409.1	11.8005439676716	TYE7	Zipper-Type	; acc "YOR344C" ; collection "CORE" ; family "Helix-Loop-Helix" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
CN0061.1	24.9768450611339	LM61	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGTCAGCATTTCCATTATRA" ; medline "17442748" ; species "9606" 
MA0304.1	11.5296732523564	GCR1	Other	; acc "YPL075W" ; collection "CORE" ; family "Other" ; medline "10487868" ; species "4932" ; tax_group "fungi" ; type "COMPILED" 
MA0399.1	7.49076039445363	SUT1	Zinc-coordinating	; acc "YGL162W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
PH0175.1	12.1464446887961	Vax2	Helix-Turn-Helix 	; acc "Q9WTP9" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0005.1	10.6110917817928	Bbx	Other Alpha-Helix	; acc "Q8VBW5" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box)" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0057.1	16	ACCTGTTG	Unknown	; MCS "20.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0231.1	8.02161083249356	lbe	Helix-Turn-Helix	; acc "Q9VDA1" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PH0149.1	13.7813515695082	Pou3f4	Helix-Turn-Helix 	; acc "P62515" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0163.1	15.0783312276132	Six3	Helix-Turn-Helix 	; acc "Q62233" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0425.1	10.258963128398	YGR067C	Zinc-coordinating	; acc "YGR067C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PH0130.1	13.5985980913496	Otx2	Helix-Turn-Helix 	; acc "P80206" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0107.1	13.931111951044	Msx2	Helix-Turn-Helix 	; acc "Q03358" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0152.1	15.6992705041585	Pou6f1_2	Helix-Turn-Helix 	; acc "Q07916" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0060.1	12.6755052763507	Hoxb5	Helix-Turn-Helix 	; acc "P09079" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0138.1	15.4141113795629	MYAATNNNNNNNGGC	Unknown	; MCS "11.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PH0093.1	15.7396458163337	Lhx3	Helix-Turn-Helix 	; acc "P50481" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0038.1	16	TGACCTTG	Unknown	; MCS "25.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "RORA" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "ERRALPHA" ; type "phylogenetic" 
MA0220.1	10.9344189565277	en	Helix-Turn-Helix	; acc "P02836" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0050.1	16.0080101497756	IRF1	Winged Helix-Turn-Helix	; acc "P10914" ; collection "CORE" ; comment "-" ; family "Interferon Regulatory Factor" ; medline "7687740" ; pazar_tf_id "TF0000032" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
PF0094.1	14.0741583645298	TGATTTRY	Unknown	; MCS "13.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "Gfi" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "GFI-1" ; type "phylogenetic" 
MA0207.1	10.5824265789565	achi	Helix-Turn-Helix	; acc "A1Z916" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0115.1	27.8780468034389	NR1H2::RXRA	Zinc-coordinating	; acc "P55055,P19793" ; collection "CORE" ; comment "heterodimer between NR1H2 and RXR" ; family "Hormone-nuclear Receptor" ; medline "10187832" ; pazar_tf_id "TF0000080" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
MA0351.1	13.3513256785677	DOT6	Helix-Turn-Helix	; acc "YER088C" ; collection "CORE" ; family "Myb" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
PH0160.1	12.5901261909705	Shox2	Helix-Turn-Helix 	; acc "P70390" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0073.1	21.9843349945475	LM73	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "ATGGAAACAGATGGT" ; medline "17442748" ; species "9606" 
PF0116.1	16.1343473680798	KMCATNNWGGA	Unknown	; MCS "12.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
POL010.1	6.19324453715487	DCE_S_III	Unknown	; Description "The DCE consists of three subelements, and each is distinct from the DPE sequence: S_I is CTTC, S_II is CTGT, and S_III is AGC. S_I resides approximately from +6 to +11, S_II from +16 to +21, and S_III from +30 to +34. (Lee et al.). The matrix are built b" ; End relative to TSS "+34" ; Start relative to TSS "+30" ; acc "" ; collection "POLII" ; comment "-" ; medline "16227614" ; species "" 
MA0239.1	9.60193933972294	prd	Helix-Turn-Helix	; acc "P23758" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "16041365" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
CN0193.1	23.7471950518708	LM193	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GTTCTCTGAAATGAAGT" ; medline "17442748" ; species "9606" 
PF0131.1	13.0000823381506	GATAAGR	Unknown	; MCS "11.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "Evi1" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "GATA-X" ; type "phylogenetic" 
MA0335.1	13.7997061423573	MET4	Zipper-Type	; acc "YNL103W" ; collection "CORE" ; family "Leucine Zipper" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
MA0032.1	6.50807164809114	FOXC1	Winged Helix-Turn-Helix	; acc "Q12948" ; collection "CORE" ; comment "-" ; family "Forkhead" ; medline "7957066" ; pazar_tf_id "TF0000020" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
MA0298.1	12	FZF1	Zinc-coordinating	; acc "YGL254W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PB0044.1	11.5195019382785	Myb	Helix-Turn-Helix 	; acc "P06876" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Myb  " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0128.1	12.362375216475	EmBP-1	Zipper-Type	; acc "P25032" ; collection "CORE" ; comment "-" ; family "Leucine Zipper" ; medline "10561063" ; species "4565" ; tax_group "plants" ; type "SELEX" 
PB0053.1	15.5751923432451	Rfx3	Winged Helix-Turn-Helix 	; acc "P48381" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "RFX  " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0151.1	16.8532575371761	RYAAAKNNNNNNTTGW	Unknown	; MCS "10.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PF0071.1	14.1157863137353	SYATTGTG	Unknown	; MCS "17.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0336.1	12.2206304473175	MGA1	Winged Helix-Turn-Helix	; acc "YGR249W" ; collection "CORE" ; family "Transcription Factor" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
MA0068.1	11.0044478832836	Pax4	Helix-Turn-Helix	; acc "P32115" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "10567552" ; pazar_tf_id "TF0000044" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
MA0196.1	9.01148283143862	NK7.1	Helix-Turn-Helix	; acc "O61640" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PF0143.1	19.3939103130365	CAGNWMCNNNGAC	Unknown	; MCS "10.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
CN0080.1	24.5412801351407	LM80	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "AGCAATTAACCTTY" ; medline "17442748" ; species "9606" 
MA0325.1	11.542688957044	LYS14	Zinc-coordinating	; acc "YDR034C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
CN0143.1	23.5045583691905	LM143	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CATTAATCAGMATT" ; medline "17442748" ; species "9606" 
MA0361.1	9.76342404942796	RDS1	Zinc-coordinating	; acc "YCR106W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0124.1	11.1268616865409	NKX3-1	Helix-Turn-Helix	; acc "Q99801" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "10871372" ; pazar_tf_id "TF0000819" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
CN0109.1	24.2923164703666	LM109	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WKCTGTSAWTCAMAR" ; medline "17442748" ; species "9606" 
CN0205.1	23.908000825804	LM205	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TTTCAAGTCAAAACA" ; medline "17442748" ; species "9606" 
PF0147.1	16.5063350145917	YAATNANRNNNCAG	Unknown	; MCS "10.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PB0043.1	14.2547974122237	Mtf1	Zinc-coordinating 	; acc "Q07243" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0121.1	15.829516146631	Obox1	Helix-Turn-Helix 	; acc "Q9D350" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0022.1	12.9045842260907	dl_1	Ig-fold	; acc "P15330" ; collection "CORE" ; comment "dl has a dual binding specificity and therefore two models: MA0022 and MA0023" ; family "Rel Homology Region" ; medline "1582412" ; species "7227" ; tax_group "insects" ; type "SELEX" 
MA0203.1	11.4189030450907	Scr	Helix-Turn-Helix	; acc "P09077" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PL0005.1	14.5225614892206	hlh-30	Zipper-type	; acc "P91527" ; collection "PBM_HLH" ; comment "homodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" 
PF0162.1	14.692517104862	TAANNYSGCG	Unknown	; MCS "9.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
CN0126.1	22.9392974244307	LM126	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "YTGCTCTAATTGCA" ; medline "17442748" ; species "9606" 
PF0129.1	14.0448717153072	RRAGTTGT	Unknown	; MCS "11.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0238.1	11.5276807051758	pb	Helix-Turn-Helix	; acc "P31264" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
CN0192.1	25.4423882390788	LM192	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WTKWMMTTTKVAAAKKWMAW" ; medline "17442748" ; species "9606" 
CN0033.1	21.1908979508842	LM33	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GWAATTGGAAACAKCTG" ; medline "17442748" ; species "9606" 
PL0018.1	16.0449572432308	hlh-25	Zipper-type	; acc "Q18054" ; collection "PBM_HLH" ; comment "homodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" 
MA0261.1	8.89281451812391	lin-14	Other	; acc "Q21446" ; collection "CORE" ; comment "-" ; family "Other" ; medline "16314527 " ; species "6239" ; tax_group "nematodes" ; type "SELEX" 
CN0140.1	22.9283589212942	LM140	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GTGACCTTTTGTTC" ; medline "17442748" ; species "9606" 
PH0044.1	12.7610530812658	Homez	Helix-Turn-Helix 	; acc "Q80W88" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0004.1	13.2132469210344	Nkx3-2	Helix-Turn-Helix 	; acc "P97503" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0210.1	7.63718140901969	ara	Helix-Turn-Helix	; acc "Q24248" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PF0079.1	14.0344876453022	WGGAATGY	Unknown	; MCS "16.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "TEAD" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "TEF-1" ; type "phylogenetic" 
MA0332.1	12	MET28	Zipper-Type	; acc "YIR017C" ; collection "CORE" ; family "Leucine Zipper" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
PB0088.1	12.0106172805705	Tcfe2a	Zipper-Type 	; acc "P15806" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Helix-Loop-Helix " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0346.1	8.10167643031295	NHP6B	Other Alpha-Helix	; acc "YBR089C-A" ; collection "CORE" ; family "High Mobility Group (Box)" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
MA0405.1	9.32443747400035	TEA1	Zinc-coordinating	; acc "YOR337W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0308.1	13.3757121553004	GSM1	Zinc-coordinating	; acc "YJL103C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
MA0386.1	14.714399703885	TBP	Beta-sheet	; acc "YER148W" ; collection "CORE" ; family "TATA box-binding" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
MA0278.1	15.8458970346948	BAS1	Helix-Turn-Helix	; acc "YKR099W" ; collection "CORE" ; family "Myb" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
PH0008.1	12.0194708213547	Barx2	Helix-Turn-Helix 	; acc "O08686" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0154.1	16.8135960068403	RNCTGNYNRNCTGNY	Unknown	; MCS "10.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0422.1	11.4055232158927	YDR520C	Zinc-coordinating	; acc "YDR520C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0327.1	13	MATA1	Helix-Turn-Helix	; acc "YCR97W" ; collection "CORE" ; family "Homeo" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
CN0133.1	22.4359583641439	LM133	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "ACAGCCATAAATCAC" ; medline "17442748" ; species "9606" 
PH0094.1	13.0947085709642	Lhx4	Helix-Turn-Helix 	; acc "P53776" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0089.1	23.7300516279747	LM89	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GTAATTGATTCCAGATG" ; medline "17442748" ; species "9606" 
MF0004.1	5.37601831905227	Nuclear Receptor class	Nuclear receptor	; acc "" ; collection "FAM" ; comment "-" ; included_models "MA0007,MA0016,MA0017,MA0065,MA0066,MA0071,MA0072,MA0074" ; medline "15066426" ; species "" ; type "METAMODEL" 
MF0003.1	10.9553785258347	REL class	REL	; acc "" ; collection "FAM" ; comment "-" ; included_models "MA0022,MA0023,MA0061,MA0101,MA0105,MA0107" ; medline "15066426" ; species "" ; type "METAMODEL" 
MA0110.1	12.8142114788194	ATHB-5	Helix-Turn-Helix	; acc "11762265" ; collection "CORE" ; comment "updated matrix since last release" ; family "Homeo" ; medline "11247607" ; species "3702" ; tax_group "plants" ; type "SELEX" 
CN0144.1	23.5111415837395	LM144	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGCTAATGAGGCCAAGGT" ; medline "17442748" ; species "9606" 
CN0199.1	22.6897025497925	LM199	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GCTCTGGAAATTTCCAG" ; medline "17442748" ; species "9606" 
CN0121.1	23.5111886114074	LM121	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "AGCTGCAAATTGCATTC" ; medline "17442748" ; species "9606" 
CN0152.1	23.8612986107125	LM152	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WRRKAARYSAYTTMTCT" ; medline "17442748" ; species "9606" 
PH0134.1	10.1896897327579	Pbx1	Helix-Turn-Helix 	; acc "P41778" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0133.1	9.91874277433396	Pax7	Helix-Turn-Helix 	; acc "P47239" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0028.1	13.3842277857385	Hbp1	Other Alpha-Helix 	; acc "Q8R316" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0047.1	12.4332203333019	Foxa2	Winged Helix-Turn-Helix	; acc "P32182" ; collection "CORE" ; comment "-" ; family "Forkhead" ; medline "8139574" ; pazar_tf_id "TF0000029" ; species "10116" ; tax_group "vertebrates" ; type "COMPILED" 
CN0093.1	22.1638209243471	LM93	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "YAAAGTGCTTTGAGCTCCTTGGA" ; medline "17442748" ; species "9606" 
PL0002.1	14.7315036406637	hlh-2::hlh-3	Zipper-type	; acc "Q17588,Q22717" ; collection "PBM_HLH" ; comment "heterodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" 
PL0007.1	13.4240675791408	mxl-3	Zipper-type	; acc "Q18711" ; collection "PBM_HLH" ; comment "homodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" 
PB0057.1	10.8476112616458	Spi1	Winged Helix-Turn-Helix 	; acc "P17433" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Ets  " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0392.1	9.01443631660008	STB5	Zinc-coordinating	; acc "YHR178W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0269.1	13.6217781718898	AFT1	Other	; acc "YGL071W" ; collection "CORE" ; family "Other" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
CN0032.1	20.3585125615029	LM32	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTGACATTTYCAAA" ; medline "17442748" ; species "9606" 
MA0331.1	11.804968670549	MCM1	Other Alpha-Helix	; acc "YMR043W" ; collection "CORE" ; family "MADS Box" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" 
CN0209.1	23.967721068214	LM209	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CATTTCCTTTGTGGAATGAG" ; medline "17442748" ; species "9606" 
MA0388.1	9.75124585550647	SPT23	Other	; acc "YKL020C" ; collection "CORE" ; family "Other" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
MA0202.1	11.6613546583819	Rx	Helix-Turn-Helix	; acc "Q9W2Q1" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PH0171.1	13.9613008582369	Nkx2-1	Helix-Turn-Helix 	; acc "P50220" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0063.1	12.3499533604175	Hoxb8	Helix-Turn-Helix 	; acc "P09632" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0015.1	13.5636758680828	Foxa2	Winged Helix-Turn-Helix 	; acc "P35583" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Forkhead  " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0172.1	16.003427466101	TTGCWCAAY	Unknown	; MCS "9.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "C/EBPBETA" ; type "phylogenetic" 
PF0133.1	16.6548422231793	RYTAAWNNNTGAY	Unknown	; MCS "11.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PF0111.1	14.0390973145781	RACCACAR	Unknown	; MCS "12.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "RUNX1" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "AML" ; type "phylogenetic" 
MA0019.1	11.6518212262485	Ddit3::Cebpa	Zipper-Type	; acc "Q62857,P05554" ; collection "CORE" ; comment "dimer between Ddit3 and Cebpa" ; family "Leucine Zipper" ; medline "8657121" ; species "10116" ; tax_group "vertebrates" ; type "SELEX" 
PH0156.1	13.6233680375039	Rax	Helix-Turn-Helix 	; acc "O35602" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0103.1	18.4778049020768	ACAWNRNSRCGG	Unknown	; MCS "13.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0036.1	5.68777359118543	GATA2	Zinc-coordinating	; acc "P23769" ; collection "CORE" ; comment "-" ; family "GATA" ; medline "8321207" ; pazar_tf_id "TF0000023" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
PF0159.1	16.8548444626024	GGCKCATGS	Unknown	; MCS "9.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
CN0161.1	22.1779571465156	LM161	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTAATGATTTCCTG" ; medline "17442748" ; species "9606" 
CN0001.1	18.7548948672918	LM1	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "YKGTTKCCATGGMAACMR" ; medline "17442748" ; species "9606" 
PH0095.1	14.8289244791633	Lhx5	Helix-Turn-Helix 	; acc "P61375" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0135.1	13.0540742658084	Phox2a	Helix-Turn-Helix 	; acc "Q62066" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0163.1	17.12910262009	GGARNTKYCCA	Unknown	; MCS "9.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0189.1	9.21447695220147	E5	Helix-Turn-Helix	; acc "Q9VFQ3" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0161.1	6.98267909425061	NFIC	Other	; acc "P08651" ; collection "CORE" ; comment "Half-site reported based on MEME analysis of SELEX sequences" ; family "Nuclear Factor I-CCAAT-binding Transcription Factor (NFI-CTF)" ; medline "12101405" ; pazar_tf_id "TF0000368" ; species "9606" ; tax_group "vertebrates" ; type "High-throughput SELEX SAGE" 
MA0080.2	9.64024742918024	SPI1	Winged Helix-Turn-Helix	; acc "P17947" ; collection "CORE" ; comment "Annotations from PAZAR PU.1 in the pleiades genes project (TF0000134)." ; family "Ets" ; medline "17916232 " ; pazar_tf_id "TF0000056" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" 
CN0056.1	24.9100786371029	LM56	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTCATTAATCAAAG" ; medline "17442748" ; species "9606" 
PB0098.1	15.3320746226117	Zfp691	Zinc-coordinating	; acc "Q3TDE8" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0158.1	15.6163105114081	CCCNNNNNNAAGWT	Unknown	; MCS "10.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0217.1	7.45558741625092	caup	Helix-Turn-Helix	; acc "P54269" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0007.1	15.703395549218	Ar	Zinc-coordinating	; acc "P15207" ; collection "CORE" ; comment "-" ; family "Hormone-nuclear Receptor" ; medline "1491700" ; pazar_tf_id "TF0000005" ; species "10117" ; tax_group "vertebrates" ; type "SELEX" 
PF0125.1	15.1198084909393	RAAGNYNNCTTY	Unknown	; MCS "11.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
CN0129.1	24.3087284745856	LM129	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WGMCAGATGRTMTKKNW" ; medline "17442748" ; species "9606" 
MA0070.1	14.6408952002356	PBX1	Helix-Turn-Helix	; acc "Q5T486" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "7910944" ; pazar_tf_id "TF0000046" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
MA0060.1	12.9251245779655	NFYA	Other Alpha-Helix	; acc "P23511" ; collection "CORE" ; comment "-" ; family "NF-Y CCAAT-Binding Protein" ; medline "9469818" ; species "9606,10090,10116,9031,8355,8364,9913,9986" ; tax_group "vertebrates" ; type "COMPILED" 
CN0098.1	25.3783034419564	LM98	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GATTTGCATTTCATTTGCAY" ; medline "17442748" ; species "9606" 
PB0046.1	10.9088659857582	Myf6	Zipper-Type 	; acc "P15375" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Helix-Loop-Helix " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0118.1	13.842212288599	Nkx6-1_1	Helix-Turn-Helix 	; acc "Q99MA9" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0070.1	12.7473494841574	Hoxc5	Helix-Turn-Helix 	; acc "P32043" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0092.1	23.4779881360103	LM92	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTAATTTGATTTGGCAGA" ; medline "17442748" ; species "9606" 
PH0075.1	11.6838884145493	Hoxd10	Helix-Turn-Helix 	; acc "P28359" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0152.1	15.1677708035863	WCAANNNYCAG	Unknown	; MCS "10.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PH0048.1	14.6728478386423	Hoxa13	Helix-Turn-Helix 	; acc "PQ62424" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0159.1	11.7569608349764	Rhox6	Helix-Turn-Helix 	; acc "Q8BPD6" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0051.1	22.8104729274088	LM51	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CATTTGCATATGCAAAT" ; medline "17442748" ; species "9606" 
PH0053.1	13.2260901128957	Hoxa6	Helix-Turn-Helix 	; acc "P09092" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0021.1	20.3301929929989	GGAANCGGAANY	Unknown	; MCS "37.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
CN0104.1	23.1811991379051	LM104	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TTGACCTTTAAAGCW" ; medline "17442748" ; species "9606" 
MA0156.1	12.1208832040133	FEV	Winged Helix-Turn-Helix	; acc "Q99581" ; collection "CORE" ; comment "Annotations from PAZAR FEV_RAT + FEV_HUMAN (TF0000158, TF0000163) in the pleiades genes project." ; family "Ets" ; medline "17916232" ; pazar_tf_id "TF0000163" ; species "10116,9606" ; tax_group "vertebrates" ; type "COMPILED" 
PF0058.1	13.0044028015871	YCATTAA	Unknown	; MCS "20.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "IPF1(*)" ; type "phylogenetic" 
MA0273.1	11.0971354082896	ARO80	Zinc-coordinating	; acc "YDR421W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
CN0170.1	23.6694106453484	LM170	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WNNCTTGTAAWTMAGAR" ; medline "17442748" ; species "9606" 
MA0024.1	13.8381257170687	E2F1	Winged Helix-Turn-Helix	; acc "NP_005216" ; collection "CORE" ; comment "-" ; family "Transcription Factor" ; medline "1411535" ; pazar_tf_id "TF0000014" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" 
MA0137.2	13.1188406182014	STAT1	Ig-fold	; acc "Q53XW4" ; collection "CORE" ; comment "-" ; family "Stat Protein" ; medline "17558387" ; pazar_tf_id "TF0000829" ; species "9606" ; tax_group "vertebrates" ; type "ChiP-seq" 
MA0153.1	7.96992534516199	HNF1B	Helix-Turn-Helix	; acc "P56693,P35680" ; collection "CORE" ; comment "Annotations from PAZAR HNF1B_HUMAN + HNF1B_MOUSE (TF0000780, TF0000782) in the TFe project." ; family "Homeo" ; medline "17916232" ; pazar_tf_id "TF0000780" ; species "10116,9606,10090,9606,10090" ; tax_group "vertebrates" ; type "COMPILED" 
MA0415.1	15.8469438675376	YAP1	Zipper-Type	; acc "YML007W" ; collection "CORE" ; family "Leucine Zipper" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
CN0107.1	24.6655887499234	LM107	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WKMAATTAGCCATCTG" ; medline "17442748" ; species "9606" 
MA0168.1	10.2596443736303	B-H1	Helix-Turn-Helix	; acc "Q24255" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0122.1	8.54224977193481	Nkx3-2	Helix-Turn-Helix	; acc "P97503" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "12746429" ; pazar_tf_id "TF0000084" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
CN0230.1	23.993025417076	LM230	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGGAATTCAAAACACATT" ; medline "17442748" ; species "9606" 
CN0034.1	21.9281803506367	LM34	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WSATTTGCATTGCAAATGM" ; medline "17442748" ; species "9606" 
CN0096.1	23.0285780344639	LM96	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WNNNNNWWMWTWRMWKYWAWKTAR" ; medline "17442748" ; species "9606" 
MA0041.1	12.9448284802064	Foxd3	Winged Helix-Turn-Helix	; acc "Q63245" ; collection "CORE" ; comment "-" ; family "Forkhead" ; medline "8139574" ; species "10116" ; tax_group "vertebrates" ; type "SELEX" 
CN0146.1	24.0907530540881	LM146	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CCTYTGCTGCCCTCTWVTG" ; medline "17442748" ; species "9606" 
PB0090.1	12.7951771056686	Zbtb3	Zinc-coordinating	; acc "Q91X45" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0142.1	14.8078141694759	Pou5f1	Helix-Turn-Helix	; acc "P20263" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18555785" ; pazar_tf_id "-" ; species "10090" ; tax_group "vertebrates" ; type "Chip-seq" 
PH0014.1	14.8274658995995	Cphx	Helix-Turn-Helix 	; acc "Q8BX39" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0084.1	22.6877368350239	LM84	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GACATCTGGTKGCAATTTG" ; medline "17442748" ; species "9606" 
CN0141.1	24.331115467769	LM141	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WGCCAAAMCAAACAGN" ; medline "17442748" ; species "9606" 
MA0286.1	11.5946833908093	CST6	Zipper-Type	; acc "YIL036W" ; collection "CORE" ; family "Leucine Zipper" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
CN0111.1	24	LM111	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTGACCTACTTT" ; medline "17442748" ; species "9606" 
MA0401.1	11.9296350390708	SWI4	Ig-fold	; acc "YER111C" ; collection "CORE" ; family "Rel Homology Region" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
CN0231.1	24.3421214508928	LM231	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CCACATCTGGAAAAG" ; medline "17442748" ; species "9606" 
SA0001.1	8.98345403774424	at_AC_acceptor	Unknown	; acc "" ; collection "SPLICE" ; comment "-" ; description "Non-canonical splice acceptor (3') site (at_AC)" ; medline "15475254" ; species "" 
MA0114.1	9.61741421120951	HNF4A	Zinc-coordinating	; acc "P41235" ; collection "CORE" ; comment "-" ; family "Hormone-nuclear Receptor" ; medline "12385991" ; species "" ; tax_group "vertebrates" ; type "COMPILED" 
MA0318.1	10.7083570785287	HMRA2	Helix-Turn-Helix	; acc "YCR096C" ; collection "CORE" ; family "Homeo" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PH0109.1	12.5138385856952	Nkx1-1	Helix-Turn-Helix 	; acc "O08713" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0420.1	11.4350310917037	YBR239C	Zinc-coordinating	; acc "YBR239C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PB0039.1	14.2089928905647	Lef1	Other Alpha-Helix 	; acc "P27782" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0038.1	13.657081013659	Klf7	Zinc-coordinating 	; acc "Q99JB0" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0385.1	7.97809298633165	SOK2	Other	; acc "YMR016C" ; collection "CORE" ; family "KilA-N" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0137.1	18.4309054542189	STAT1	Ig-fold	; acc "Q53XW4" ; collection "CORE" ; comment "-" ; family "Stat Protein" ; medline "17558387" ; pazar_tf_id "TF0000829" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" 
MA0393.1	10.3114373059978	STE12	Helix-Turn-Helix	; acc "YHR084W" ; collection "CORE" ; family "Homeo" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" 
CN0050.1	25.9998942976244	LM50	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGGGTAATTACATTCTGYY" ; medline "17442748" ; species "9606" 
CN0114.1	23.3995604087411	LM114	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TTTCCAATTAAGCT" ; medline "17442748" ; species "9606" 
MA0312.1	10.1207098487735	HAP1	Zinc-coordinating	; acc "YLR256W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
CN0162.1	23.313636307951	LM162	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "YCATTAGGAAGACAAATGR" ; medline "17442748" ; species "9606" 
PH0003.1	14.2792730321785	Arx	Helix-Turn-Helix 	; acc "O35085" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0003.1	7.81209200796467	TFAP2A	Zipper-Type	; acc "P05549" ; collection "CORE" ; comment "-" ; family "Helix-Loop-Helix" ; medline "10497269" ; pazar_tf_id "TF0000002" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
MA0379.1	9.57365790930011	SIG1	Zinc-coordinating	; acc "YER068W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0439.1	9.9590652262495	YRR1	Zinc-coordinating	; acc "YOR162C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PF0113.1	19.611252601661	AACYNNNNTTCCS	Unknown	; MCS "12.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PL0006.1	11.8527025830916	hlh-2::lin-32	Zipper-type	; acc "Q17588,Q10574" ; collection "PBM_HLH" ; comment "heterodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" 
MF0008.1	9.66247378819726	MADS class	MADS	; acc "" ; collection "FAM" ; comment "-" ; included_models "MA0001,MA0005,MA0052,MA0082,MA0083" ; medline "15066426" ; species "" ; type "METAMODEL" 
PF0135.1	15.1153861586506	AGCYRWTTC	Unknown	; MCS "11.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0057.1	9.40029161122265	MZF1_5-13	Zinc-coordinating	; acc "P28698" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "8114711" ; pazar_tf_id "TF0000036" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
MA0246.1	10.7635738748009	so	Helix-Turn-Helix	; acc "Q27350" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0067.1	6.20567063978618	Pax2	Helix-Turn-Helix	; acc "P32114" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "8132558" ; pazar_tf_id "TF0000043" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
PH0138.1	12.9849406716533	Pitx2	Helix-Turn-Helix 	; acc "P97474" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0031.1	12.1904692468952	Hoxa3	Helix-Turn-Helix 	; acc "P02831" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0138.1	26.1002708535711	LM138	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "ACAAAAGCCAGGAAAT" ; medline "17442748" ; species "9606" 
MA0354.1	12.263821183904	PDR8	Zinc-coordinating	; acc "YLR266C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PF0023.1	12	TAATTA	Unknown	; MCS "37.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "TCF1" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "CHX10" ; type "phylogenetic" 
MA0198.1	11.3452707897821	OdsH	Helix-Turn-Helix	; acc "O96616" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PH0098.1	13.7793757861336	Lhx8	Helix-Turn-Helix 	; acc "O35652" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0204.1	10.2007154213659	Six4	Helix-Turn-Helix	; acc "Q9Y1P6" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0002.2	10.4014248709659	RUNX1	Ig-fold	; acc "Q01196" ; collection "CORE" ; comment "Data is from Frank Grosveld's Lab." ; family "Runt" ; medline "-" ; pazar_tf_id "TF0000001" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" 
MA0359.1	12.6660170473799	RAP1	Helix-Turn-Helix	; acc "YNL216W" ; collection "CORE" ; family "Myb" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PH0110.1	11.8164886808522	Nkx1-2	Helix-Turn-Helix 	; acc "P42580" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0023.1	12.5107535494658	Dlx4	Helix-Turn-Helix 	; acc "P70436" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0216.1	24.1921364522253	LM216	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TTTCTCTTTGAAACCTGCAA" ; medline "17442748" ; species "9606" 
MA0131.1	13.1966529939183	MIZF	Zinc-coordinating	; acc "Q9BQA5" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "14752047" ; pazar_tf_id "TF0000823" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
MA0387.1	11.2121094420992	SPT2	Other Alpha-Helix	; acc "YER161C" ; collection "CORE" ; family "High Mobility Group (Box)" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
CN0132.1	23.3734828252666	LM132	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TRGTTCTCATTAAG" ; medline "17442748" ; species "9606" 
MA0390.1	15.9738467476943	STB3	Other	; acc "YDR169C" ; collection "CORE" ; family "Other" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
MA0368.1	12.3213310203631	RIM101	Zinc-coordinating	; acc "YHL027W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PF0033.1	14.3042683633816	YTATTTTNR	Unknown	; MCS "26.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "MEF-2" ; type "phylogenetic" 
MA0148.1	12.5328023736824	FOXA1	Winged Helix-Turn-Helix	; acc "P55317" ; collection "CORE" ; comment "-" ; family "Forkhead" ; medline "18798982" ; pazar_tf_id "TF0000263" ; species "9606" ; tax_group "vertebrates" ; type "ChiP-Seq" 
PH0035.1	14.0033896816339	Gsc	Helix-Turn-Helix 	; acc "Q02591" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0155.1	13.2589289259166	WGTTNNNNNAAA	Unknown	; MCS "10.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0233.1	7.65684512395282	mirr	Helix-Turn-Helix	; acc "O01667" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PH0111.1	13.5677351860668	Nkx2-2	Helix-Turn-Helix 	; acc "P42586" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0091.1	11.5973292484701	Zbtb7b	Zinc-coordinating	; acc "Q64321" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0301.1	7.47094843508793	GAT3	Zinc-coordinating	; acc "YLR013W" ; collection "CORE" ; family "GATA" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0371.1	15.9427249832917	ROX1	Other Alpha-Helix	; acc "YPR065W" ; collection "CORE" ; family "High Mobility Group (Box)" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
CN0101.1	25.5644512024035	LM101	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "ATTTGCATACATTTGCAT" ; medline "17442748" ; species "9606" 
PB0096.1	13.3231257158579	Zfp281	Zinc-coordinating	; acc "Q99LI5" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0037.1	15.1848286714398	Jundm2	Zipper-Type 	; acc "P97875" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Leucine Zipper " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0088.1	16.9254523550943	GGCNKCCATNK	Unknown	; MCS "14.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
CN0115.1	22.9283861763997	LM115	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CAAGATTAATKGCT" ; medline "17442748" ; species "9606" 
CN0150.1	22.9337346654183	LM150	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CATTAACCTTTAAC" ; medline "17442748" ; species "9606" 
CN0055.1	23.1977114018334	LM55	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WGCTAATTAGCACTT" ; medline "17442748" ; species "9606" 
PB0041.1	12.441460656472	Mafk	Zipper-Type 	; acc "Q61827" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Leucine Zipper " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0224.1	23.4329035924821	LM224	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "AATCATGTTTGAAAG" ; medline "17442748" ; species "9606" 
PB0078.1	13.2796520022264	Sry	Other Alpha-Helix 	; acc "Q05738" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0076.1	12	CAGGTA	Unknown	; MCS "16.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "AREB6" ; type "phylogenetic" 
CN0153.1	21.2409786898481	LM153	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "NCTGTGATTAAAGCA" ; medline "17442748" ; species "9606" 
CN0021.1	25.6661940201692	LM21	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "ATTTGCATNTCATTTGCATW" ; medline "17442748" ; species "9606" 
PB0082.1	11.8608271249051	Tcf7	Other Alpha-Helix 	; acc "Q00417" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0242.1	13.8714481144005	run::Bgb	Ig-fold	; acc "P22814,Q24040" ; collection "CORE" ; comment "Bgb is the co-activator with CBF-beta domain" ; family "Runt" ; medline "16041365" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PH0115.1	15.1056337410431	Nkx2-6	Helix-Turn-Helix 	; acc "P43688" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0172.1	12.7115623985597	CG11294	Helix-Turn-Helix	; acc "Q9W3C6" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
CN0087.1	24.7943682188293	LM87	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "RNNWWTTGAAGCAATTAGCW" ; medline "17442748" ; species "9606" 
PB0073.1	10.1662269425122	Sox8	Other Alpha-Helix 	; acc "Q04886" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0290.1	38	DAL81	Zinc-coordinating	; acc "YIR023W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
MA0152.1	9.85861516191245	NFATC2	Ig-fold	; acc "Q13469" ; collection "CORE" ; comment "Annotations from PAZAR NFAT1_MOUSE + NFAT1_HUMAN + NFAT1_RAT (TF0000191, TF0000193, TF0000195) in the pleiades genes project." ; family "Rel Homology Region" ; medline "17916232" ; pazar_tf_id "TF0000193" ; species "10090,9606,10116" ; tax_group "vertebrates" ; type "COMPILED" 
PH0091.1	14.5345052869059	Lhx1	Helix-Turn-Helix 	; acc "P63006" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0041.1	13.1751339381587	TGACAGNY	Unknown	; MCS "24.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "MEIS1" ; type "phylogenetic" 
POL013.1	11.0597140413294	MED-1	Unknown	; Description "Downstream core promoter element found in TATA-less promoters sharing similar features with the pgp1 promoter. The matrix is built from 14 promoters identified in the literature similar to the pgp1 promoter. It is often found in promoters with multiple st" ; End relative to TSS "+6 to +116" ; Start relative to TSS "+1 to +110" ; acc "" ; collection "POLII" ; comment "-" ; medline "8530439 " ; species "" 
CN0190.1	23.7872543408499	LM190	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TTAATGGCCCATGAAATGA" ; medline "17442748" ; species "9606" 
CN0181.1	23.4159903771542	LM181	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WTTTGGCTTTAATGA" ; medline "17442748" ; species "9606" 
MA0094.1	5.57649394986978	Ubx	Helix-Turn-Helix	; acc "P83949" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "1673656" ; pazar_tf_id "TF0000068" ; species "7227" ; tax_group "insects" ; type "SELEX" 
MA0076.1	14.123230134165	ELK4	Winged Helix-Turn-Helix	; acc "P28324" ; collection "CORE" ; comment "-" ; family "Ets" ; medline "8524663" ; pazar_tf_id "TF0000052" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
PF0014.1	16	TGACGTCA	Unknown	; MCS "44.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "ATF3" ; type "phylogenetic" 
PL0012.1	12.7987195368346	hlh-2::hlh-8	Zipper-type	; acc "Q17588,Q11094" ; collection "PBM_HLH" ; comment "heterodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" 
MA0163.1	19.3519112748786	PLAG1	Zinc-coordinating	; acc "Q6DJT9" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "16041365" ; pazar_tf_id "-" ; species "9606" ; tax_group "vertebrates" ; type "bacterial 1-hybrid" 
PH0083.1	12.9621936208499	Irx3_1	Helix-Turn-Helix 	; acc "P81067" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0344.1	11.861331038291	NHP10	Other Alpha-Helix	; acc "YDL002C" ; collection "CORE" ; family "High Mobility Group (Box)" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0176.1	9.41407888461203	CG15696	Helix-Turn-Helix	; acc "Q9VDH9" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PH0123.1	14.8311476408505	Obox3	Helix-Turn-Helix 	; acc "Q8VHG6" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0176.1	13.8958515689278	Vsx1	Helix-Turn-Helix 	; acc "Q91V10" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0121.1	9.59458248131567	ARR10	Helix-Turn-Helix	; acc "O49397" ; collection "CORE" ; comment "-" ; family "Myb" ; medline "12215502" ; species "3702" ; tax_group "plants" ; type "SELEX" 
PH0069.1	13.5996529383899	Hoxc4	Helix-Turn-Helix 	; acc "Q08624" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0082.1	22.9365545092618	LM82	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "ACTTGACATTTGCA" ; medline "17442748" ; species "9606" 
MA0052.1	15.7090560936245	MEF2A	Other Alpha-Helix	; acc "EAX02249" ; collection "CORE" ; comment "-" ; family "MADS Box" ; medline "1748287" ; pazar_tf_id "TF0000034" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
MA0237.1	7.34150536943737	pan	Other Alpha-Helix	; acc "P91943" ; collection "CORE" ; comment "-" ; family "High Mobility Group (Box)" ; medline "15572468" ; species "7227" ; tax_group "insects" ; type "DNaseI footprinting" 
MA0429.1	8.55982138714816	YLL054C	Zinc-coordinating	; acc "YLL054C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
CN0035.1	24.5746338470254	LM35	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WRACTTCAAAGGGAGCTB" ; medline "17442748" ; species "9606" 
CN0026.1	20.2144787376821	LM26	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WAAACACAGCTGT" ; medline "17442748" ; species "9606" 
MA0095.1	8.10118850374216	YY1	Zinc-coordinating	; acc "P25490" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "7816599" ; pazar_tf_id "TF0000069" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" 
CN0182.1	24.215150095924	LM182	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TCATTTTGCAAGTGCAA" ; medline "17442748" ; species "9606" 
MA0299.1	11.5273660726939	GAL4	Zinc-coordinating	; acc "YPL248C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
MA0209.1	10.8135422763079	ap	Helix-Turn-Helix	; acc "P29673" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PH0117.1	12.9106076797827	Nkx3-1	Helix-Turn-Helix 	; acc "P97436" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0085.1	16.2160430288651	STTTCRNTTT	Unknown	; MCS "14.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "IRF2" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "IRF" ; type "phylogenetic" 
CN0200.1	29.3110239149889	LM200	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "KNNNTTTAATGGGAAATYTGMWWWK" ; medline "17442748" ; species "9606" 
PH0055.1	11.8621652130012	Hoxa7_2	Helix-Turn-Helix 	; acc "P02830" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0120.1	24.3028392363272	KRCTCNNNNMANAGC	Unknown	; MCS "11.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0109.1	7.46926530914378	Hltf	Zinc-coordinating	; acc "Q95216" ; collection "CORE" ; comment "updated matrix sincle last release" ; family "GATA" ; medline "12198246" ; species "9986" ; tax_group "vertebrates" ; type "SELEX" 
PH0030.1	13.9493438906078	Esx1	Helix-Turn-Helix 	; acc "Q9Z2U3" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0086.1	24.5037516422175	LM86	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "MAKCTGMYTTTGATY" ; medline "17442748" ; species "9606" 
MA0440.1	22.0315129199184	ZAP1	Zinc-coordinating	; acc "YJL056C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
PF0028.1	15.1499645212671	CTAWWWATA	Unknown	; MCS "32.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "MEF2A" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "RSRFC4" ; type "phylogenetic" 
CN0194.1	26.1147660982806	LM194	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "AGAGGGCAGCARAGYCCCA" ; medline "17442748" ; species "9606" 
PH0161.1	13.524720216851	Six1	Helix-Turn-Helix 	; acc "Q62231" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0352.1	10.0117868838541	PDR1	Zinc-coordinating	; acc "YGL013C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PB0042.1	12.2626216132962	Max	Zipper-Type 	; acc "P28574" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Helix-Loop-Helix " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0020.1	14.5611472665864	Gabpa	Winged Helix-Turn-Helix 	; acc "Q00422" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Ets  " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0018.1	12.6045644339298	CREB1	Zipper-Type	; acc "P16220" ; collection "CORE" ; comment "-" ; family "Leucine Zipper" ; medline "8264613" ; pazar_tf_id "TF0000013" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
PB0029.1	13.5082560514089	Hic1	Zinc-coordinating 	; acc "Q9R1Y5" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0281.1	12.4705889209419	CBF1	Zipper-Type	; acc "YJR060W" ; collection "CORE" ; family "Helix-Loop-Helix" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PF0083.1	13.0032399233547	TGTTTGY	Unknown	; MCS "15.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "Foxd3" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "HNF-3" ; type "phylogenetic" 
MA0112.1	17.6826360597729	ESR1	Zinc-coordinating	; acc "P03372" ; collection "CORE" ; comment "-" ; family "Hormone-nuclear Receptor" ; medline "15563547" ; species "9606,10090,10116,9031,8355,8364,9913,9986" ; tax_group "vertebrates" ; type "COMPILED" 
CN0042.1	22.9083601223865	LM42	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "AAGCCTAATTAGCA" ; medline "17442748" ; species "9606" 
PH0074.1	12.4583063775179	Hoxd1	Helix-Turn-Helix 	; acc "Q01822" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0062.1	14.0765210087483	SMTTTTGT	Unknown	; MCS "19.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PB0077.1	11.1271628276097	Srf	Other Alpha-Helix 	; acc "Q9JM73" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "MADS Box " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0074.1	20.4756921397386	LM74	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "AWGCCTTTGAAGTTMW" ; medline "17442748" ; species "9606" 
PB0067.1	9.17767360506708	Sox1	Other Alpha-Helix 	; acc "P53783" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0079.1	10.111671982635	Tbp	Beta-sheet 	; acc "P29037" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "TATA box-binding " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0061.1	13.3447617958635	NF-kappaB	Ig-fold	; acc "" ; collection "CORE" ; comment "-" ; family "Rel Homology Region" ; medline "8449662" ; species "9606,10090,10116,9986" ; tax_group "vertebrates" ; type "COMPILED" 
MA0021.1	9.00217674837923	Dof3	Zinc-coordinating	; acc "Q41801" ; collection "CORE" ; comment "-" ; family "Dof" ; medline "10074718" ; species "4577" ; tax_group "plants" ; type "SELEX" 
PH0092.1	12.6959041402819	Lhx2	Helix-Turn-Helix 	; acc "Q9Z0S2" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
POL005.1	3.30887839177199	DPE	Unknown	; Description "The matrix is generated from the DPE containing sequences found in the Drosophila Core Promoter Database http://www-biology.ucsd.edu/labs/Kadonaga/DCPD.htm ." ; End relative to TSS "+34" ; Start relative to TSS "+26" ; acc "" ; collection "POLII" ; comment "-" ; medline "10848601" ; species "7227" 
MA0026.1	10.3539445300757	Eip74EF	Winged Helix-Turn-Helix	; acc "P20105" ; collection "CORE" ; comment "-" ; family "Ets" ; medline "2208281" ; species "7227" ; tax_group "insects" ; type "SELEX" 
PH0131.1	13.6039838744675	Pax4	Helix-Turn-Helix 	; acc "P32115" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0398.1	9.24448020005008	SUM1	Other	; acc "YDR310C" ; collection "CORE" ; family "AT-hook" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PB0022.1	12.9570969513651	Gata5	Zinc-coordinating 	; acc "P97489" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "GATA  " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0367.1	9.78784990105933	RGT1	Zinc-coordinating	; acc "YKL038W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PF0157.1	15.8360959354586	KCCGNSWTTT	Unknown	; MCS "10.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PH0116.1	13.1719292177523	Nkx2-9	Helix-Turn-Helix 	; acc "O70584" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0075.1	9.06306510239134	Prrx2	Helix-Turn-Helix	; acc "Q06348" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "7901837" ; pazar_tf_id "TF0000051" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
PF0086.1	16.1135159736544	GGGNNTTTCC	Unknown	; MCS "14.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "RELA" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "NF-KAPPAB" ; type "phylogenetic" 
CN0155.1	26.3994585330845	LM155	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CACTAGGGKACCATTTAGT" ; medline "17442748" ; species "9606" 
CN0090.1	24.3606619768356	LM90	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTGGCAGCCTGCCAG" ; medline "17442748" ; species "9606" 
PH0127.1	10.9101150960192	Nobox	Helix-Turn-Helix 	; acc "P70367" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0049.1	13.5902493404288	Osr1	Zinc-coordinating 	; acc "Q9WVG7" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0070.1	22.7450728903571	LM70	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTGAACAGATGGCC" ; medline "17442748" ; species "9606" 
MA0140.1	11.2966184456867	Tal1::Gata1	Zipper-Type 	; acc "P22091,P17679" ; collection "CORE" ; comment "Heterodimer between TAL1 and GATA1. Data is from Frank Grosveld's Lab." ; family "Helix-Loop-Helix" ; medline "-" ; pazar_tf_id "TF0000022" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" 
PF0075.1	17.5131498899234	TNCATNTCCYR	Unknown	; MCS "16.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "STAT1(*)" ; type "phylogenetic" 
PF0006.1	13.2331518804852	GGGCGGR	Unknown	; MCS "63.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "SP1" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "SP1" ; type "phylogenetic" 
MA0350.1	13.9466782878458	TOD6	Helix-Turn-Helix	; acc "YBL054W" ; collection "CORE" ; family "Myb" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
PH0096.1	12.5669712217239	Lhx6_1	Helix-Turn-Helix 	; acc "Q9R1R0" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0025.1	14.1385069219678	NFIL3	Zipper-Type	; acc "NP_005375" ; collection "CORE" ; comment "-" ; family "Leucine Zipper" ; medline "1620116" ; pazar_tf_id "TF0000015" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
MA0127.1	10.0591277357396	PEND	Zipper-Type	; acc "BAD90707" ; collection "CORE" ; comment "-" ; family "Leucine Zipper" ; medline "9973626" ; species "3888" ; tax_group "plants" ; type "SELEX" 
MA0158.1	8.75888972531638	HOXA5	Helix-Turn-Helix	; acc "P20719" ; collection "CORE" ; comment "Annotations from PAZAR HOXA5_MOUSE + HOXA5_HUMAN (TF0000293, TF0000501) in the pleiades genes project." ; family "Homeo" ; medline "17916232" ; pazar_tf_id "TF0000501" ; species "10090,9606" ; tax_group "vertebrates" ; type "COMPILED" 
PB0040.1	14.5894412216728	Mafb	Zipper-Type 	; acc "P54841" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Leucine Zipper " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0095.1	16.7846601118016	Zfp187	Zinc-coordinating	; acc "Q5RJ54" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0008.1	11.8821478649142	HAT5	Helix-Turn-Helix	; acc "Q02283" ; collection "CORE" ; comment "homodimer" ; family "Homeo" ; medline "8253077" ; species "3702" ; tax_group "plants" ; type "SELEX" 
CN0122.1	23.7177464638423	LM122	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GMAGCTTTTAATGA" ; medline "17442748" ; species "9606" 
CN0148.1	22.9804080575699	LM148	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CAGATTGACATTTC" ; medline "17442748" ; species "9606" 
PB0002.1	10.3685890233124	Arid5a	Helix-Turn-Helix 	; acc "Q8BI45" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Arid" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0074.1	19.3843172792854	GGAMTNNNNNTCCY	Unknown	; MCS "16.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
CN0136.1	23.5479252048255	LM136	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "NKYTGCCAAGAGCAACA" ; medline "17442748" ; species "9606" 
MA0376.1	13.0280370637711	RTG3	Zipper-Type	; acc "YBL103C" ; collection "CORE" ; family "Helix-Loop-Helix" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
PF0134.1	14.0883519500891	CATRRAGC	Unknown	; MCS "11.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0145.1	11.6502911096776	Tcfcp2l1 	Other	; acc "Q3UNW5" ; collection "CORE" ; comment "-" ; family "CP2 Transcription Factor" ; medline "18555785 " ; pazar_tf_id "-" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" 
PF0173.1	16.3129279607441	YWATTWNNRGCT	Unknown	; MCS "8.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0343.1	14.5670310021016	NDT80	Ig-fold	; acc "YHR124W" ; collection "CORE" ; family "NDT80 / PhoG" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
CN0065.1	21.7486299931811	LM65	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "KCTCATTTGCATTTCAAARR" ; medline "17442748" ; species "9606" 
MA0338.1	9.18961305039914	MIG2	Zinc-coordinating	; acc "YGL209W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PB0011.1	11.4428767873256	Ehf	Winged Helix-Turn-Helix 	; acc "Q922E8" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Ets  " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0077.1	24.9424396113144	LM77	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "YRGATAATTGAGAGTTGACTR" ; medline "17442748" ; species "9606" 
MA0073.1	22.2782723704014	RREB1	Zinc-coordinating	; acc "Q92766" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "8816445" ; pazar_tf_id "TF0000049" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
PH0064.1	13.3927893499171	Hoxb9	Helix-Turn-Helix 	; acc "P20615" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
SD0003.1	12.2306695437446	at_AC_acceptor	Unknown	; acc "" ; collection "SPLICE" ; comment "-" ; description "Non-canonical splice acceptor (3') site (at_AC)" ; medline "15475254" ; species "" 
MA0104.2	11.10408707833	Mycn	Zipper-Type	; acc "P03966" ; collection "CORE" ; comment "-" ; family "Helix-Loop-Helix" ; medline "18555785" ; pazar_tf_id "TF0000075" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-Seq" 
CN0014.1	23.7373405491338	LM14	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WNATCCAGATGTTTGGCAYYW" ; medline "17442748" ; species "9606" 
PL0004.1	15.6708635675018	hlh-27	Zipper-type	; acc "Q18056" ; collection "PBM_HLH" ; comment "homodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" 
PB0076.1	11.9501279025043	Spdef	Winged Helix-Turn-Helix 	; acc "Q9WTP3" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Ets  " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0091.1	15.0711447112168	GTGGGTGK	Unknown	; MCS "14.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "RREB1" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PB0070.1	12.8968538027584	Sox4	Other Alpha-Helix 	; acc "Q06945" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0431.1	10.8941596185029	YML081W	Zinc-coordinating	; acc "YML081W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PB0034.1	13.734786996509	Irf5	Winged Helix-Turn-Helix 	; acc "P56477" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Interferon Regulatory Factor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0200.1	10.4572722909208	Pph13	Helix-Turn-Helix	; acc "Q8T0V5" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0133.1	5.26063535577042	BRCA1	Other	; acc "P38398" ; collection "CORE" ; comment "Multi-protein complex" ; family "Other" ; medline "14502648" ; pazar_tf_id "TF0000825" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
PF0080.1	21.1382301888602	SNACANNNYSYAGA	Unknown	; MCS "15.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0276.1	10.7334328074025	ASH1	Zinc-coordinating	; acc "YKL185W" ; collection "CORE" ; family "GATA" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
MA0321.1	12.8144402971823	INO2	Zipper-Type	; acc "YDR123C" ; collection "CORE" ; family "Helix-Loop-Helix" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
PB0054.1	14.8618455127864	Rfx4	Winged Helix-Turn-Helix 	; acc "Q8HWA6" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "RFX  " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0197.1	24.5286416167029	LM197	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "AAAGATGCARTATCCCTTTT" ; medline "17442748" ; species "9606" 
MA0245.1	9.51955468237743	slou	Helix-Turn-Helix	; acc "P22807" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0078.1	10.5018372361999	Sox17	Other Alpha-Helix	; acc "Q61473" ; collection "CORE" ; comment "-" ; family "High Mobility Group (Box)" ; medline "8636240" ; pazar_tf_id "TF0000054" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
PF0067.1	14.4099898423089	TGANNYRGCA	Unknown	; MCS "17.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "TCF11/MAFG" ; type "phylogenetic" 
PF0040.1	14.0600799181782	TTCYNRGAA	Unknown	; MCS "24.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "STAT5A" ; type "phylogenetic" 
MA0178.1	10.5019144943067	CG32105	Helix-Turn-Helix	; acc "Q9VTW5" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PF0044.1	14.8716187921438	YATGNWAAT	Unknown	; MCS "23.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "OCT-X" ; type "phylogenetic" 
CN0232.1	24.4994736532216	LM232	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGGAAGCAGTGAAACAAATG" ; medline "17442748" ; species "9606" 
MA0253.1	12.8905663562585	vnd	Helix-Turn-Helix	; acc "P22808" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0307.1	7.86116233931669	GLN3	Zinc-coordinating	; acc "YER040W" ; collection "CORE" ; family "GATA" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PF0161.1	16.5770786874249	TTANWNANTGGM	Unknown	; MCS "9.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
POL012.1	10.1980738528127	TATA-Box	Unknown	; Description "The dominating  motif TATA ( first T in TATAT) is located in a preferred region from -32 to -28 relative to the TSS (see pub med 16916456). This model is also housed in JASPAR CORE (MA0108)" ; End relative to TSS "-25 to -9" ; Start relative to TSS "-39 to -23" ; acc "" ; collection "POLII" ; comment "-" ; medline "2329577" ; species "" 
MA0059.1	14.2370460691273	MYC::MAX	Zipper-Type	; acc "AAH36092,Q6LBK7" ; collection "CORE" ; comment "Heterodimer of MYC and MAX " ; family "Helix-Loop-Helix" ; medline "8265351" ; pazar_tf_id "TF0000038" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
CN0188.1	23.5208879545282	LM188	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TCTGACAGAAATGTCAA" ; medline "17442748" ; species "9606" 
MA0191.1	10.3660720181329	HGTX	Helix-Turn-Helix	; acc "Q9NHP8" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PF0011.1	15.0359795013411	MGGAAGTG	Unknown	; MCS "51.6" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "GABPA" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "GABP" ; type "phylogenetic" 
PF0078.1	14.500168388317	GCTNWTTGK	Unknown	; MCS "16.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0170.1	9.16929973957508	C15	Helix-Turn-Helix	; acc "Q7KS72" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PB0059.1	11.0194253770457	Smad3	Zinc-coordinating 	; acc "Q8BUN5" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "MH1  " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0064.1	12.0175401946116	TTANTCA	Unknown	; MCS "18.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "AP-1(*)" ; type "phylogenetic" 
CN0220.1	25.2660551768414	LM220	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "ATGGCACTTTGGAAAATGGA" ; medline "17442748" ; species "9606" 
MA0432.1	11.9460838565474	YNR063W	Zinc-coordinating	; acc "YNR063W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PH0010.1	13.5994379418609	Alx1_1	Helix-Turn-Helix 	; acc "Q8C8B0" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0089.1	12.8737946910922	Isx	Helix-Turn-Helix 	; acc "A1A546" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0009.1	22.0665388934836	LM9	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TTCAGCACCWYGGACAGMKMC" ; medline "17442748" ; species "9606" 
POL008.1	4.14047794920485	DCE_S_I	Unknown	; Description "The DCE consists of three subelements, and each is distinct from the DPE sequence: S_I is CTTC, S_II is CTGT, and S_III is AGC. S_I resides approximately from +6 to +11, S_II from +16 to +21, and S_III from +30 to +34. (Lee et al.). The matrix is built ba" ; End relative to TSS "+11" ; Start relative to TSS "+6" ; acc "" ; collection "POLII" ; comment "-" ; medline "16227614" ; species "" 
PF0001.1	17.0417134599259	RCGCANGCGY	Unknown	; MCS "107.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "NRF-1" ; type "phylogenetic" 
PF0013.1	12	CTTTGT	Unknown	; MCS "46.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "LEF1" ; type "phylogenetic" 
MA0035.2	10.877868413799	Gata1	Zinc-coordinating 	; acc "P17679" ; collection "CORE" ; comment "Data is from Frank Grosveld's Lab. " ; family "GATA" ; medline "-" ; pazar_tf_id "TF0000022" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" 
MA0426.1	12	YHP1	Helix-Turn-Helix	; acc "YDR451C" ; collection "CORE" ; family "Homeo" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
PB0071.1	12.0195150888603	Sox5	Other Alpha-Helix 	; acc "P35710" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0188.1	11.84513333609	Dr	Helix-Turn-Helix	; acc "Q03372" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0016.1	13.7920230760767	usp	Zinc-coordinating	; acc "P20153" ; collection "CORE" ; comment "-" ; family "Hormone-nuclear Receptor" ; medline "1280827" ; species "7227" ; tax_group "insects" ; type "SELEX" 
MA0306.1	9.99503776771591	GIS1	Zinc-coordinating	; acc "YDR096W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0315.1	12.4143517923914	HAP4	Other Alpha-Helix	; acc "YKL109W" ; collection "CORE" ; family "NF-Y CCAAT-Binding Protein" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
MA0079.1	9.7185757452318	SP1	Zinc-coordinating	; acc "P08047" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "2192357" ; pazar_tf_id "TF0000055" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
MA0195.1	8.71357094394002	Lim3	Helix-Turn-Helix	; acc "Q9VJ02" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0251.1	10.6608585931509	unpg	Helix-Turn-Helix	; acc "Q4V5A3" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0091.1	14.0701377487026	TAL1::TCF3	Zipper-Type	; acc "P17542,P15923" ; collection "CORE" ; comment "Heterodimer between TAL1 and TCF3" ; family "Helix-Loop-Helix" ; medline "8289805" ; pazar_tf_id "TF0000065" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
CN0088.1	23.6319870327433	LM88	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WRGTTAATTGGAATCANW" ; medline "17442748" ; species "9606" 
PH0100.1	13.6622751564181	Lmx1a	Helix-Turn-Helix 	; acc "Q9JKU8" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0063.1	22.7972241099222	LM63	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGATTTATGAGGTG" ; medline "17442748" ; species "9606" 
CN0176.1	24.3378041695922	LM176	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GAGCCAGCTGGCTCM" ; medline "17442748" ; species "9606" 
PH0034.1	14.1527066083212	Gbx2	Helix-Turn-Helix 	; acc "P48031" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0080.1	10.8390773372516	Tcf1	Helix-Turn-Helix 	; acc "Q66JY7" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0053.1	18.8958345972212	RYTGCNNRGNAAC	Unknown	; MCS "21.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "MIF-1" ; type "phylogenetic" 
MA0183.1	8.44684290542566	CG7056	Helix-Turn-Helix	; acc "Q9VDF0" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0102.2	8.71217594697575	CEBPA	Zipper-Type	; acc "-" ; collection "CORE" ; comment "last 3 nt removed" ; family "Leucine Zipper" ; medline "1672737" ; species "-" ; tax_group "vertebrates" ; type "COMPILED" 
MA0175.1	10.2453717795788	CG13424	Helix-Turn-Helix	; acc "A1ZBV6" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PF0073.1	12	CTTTGA	Unknown	; MCS "17.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "NR1H2-RXR" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "LEF1" ; type "phylogenetic" 
PB0016.1	10.8067733282855	Foxj1	Winged Helix-Turn-Helix 	; acc "Q61660" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Forkhead  " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0102.1	9.18699952114279	Cebpa	Zipper-Type	; acc "" ; collection "CORE" ; comment "-" ; family "Leucine Zipper" ; medline "1672737" ; species "10090,10116" ; tax_group "vertebrates" ; type "COMPILED" 
PH0102.1	15.7929524600364	Meis1	Helix-Turn-Helix 	; acc "Q60954" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0264.1	12.5462910458534	ceh-22	Helix-Turn-Helix	; acc "P41936" ; collection "CORE" ; comment "NK-2 class; ortholog to Drosophila tinman and vertebrate Nkx2-5" ; family "Homeo" ; medline "16998473" ; species "6239" ; tax_group "nematodes" ; type "PBM" 
PB0084.1	10.8017848161126	Tcfap2a	Zipper-Type 	; acc "P34056" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Helix-Loop-Helix " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0148.1	18.2162185369208	GATGKMRGCG	Unknown	; MCS "10.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0291.1	9.34099948469802	DAL82	Other	; acc "YNL314W" ; collection "CORE" ; family "Other" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
SA0002.1	9.10739671864104	at_AC_acceptor	Unknown	; acc "" ; collection "SPLICE" ; comment "-" ; description "Non-canonical splice acceptor (3') site (at_AC)" ; medline "15475254" ; species "" 
PH0103.1	11.8789712302861	Meox1	Helix-Turn-Helix 	; acc "P32442" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0045.1	14.0837125498192	Hoxa1	Helix-Turn-Helix 	; acc "P09022" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0098.1	16.3356838349734	GTCNYYATGR	Unknown	; MCS "13.6" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PB0012.1	10.2599592757308	Elf3	Winged Helix-Turn-Helix 	; acc "Q3UPW2" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Ets  " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0179.1	23.4531875277397	LM179	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "MTKNYWRATKMATYWRKMAR" ; medline "17442748" ; species "9606" 
MA0063.1	8.26972545955296	Nkx2-5	Helix-Turn-Helix	; acc "P42582" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "7797561" ; pazar_tf_id "TF0000040" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
CN0019.1	24.1392804486059	LM19	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGCTAATTAGCAGCH" ; medline "17442748" ; species "9606" 
PF0087.1	17.7580202976952	RYTGCNWTGGNR	Unknown	; MCS "14.6" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0030.1	14.8237690744434	FOXF2	Winged Helix-Turn-Helix	; acc "Q12947" ; collection "CORE" ; comment "-" ; family "Forkhead" ; medline "7957066" ; pazar_tf_id "TF0000019" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
MA0001.1	10.5882147138157	AGL3	Other Alpha-Helix	; acc "P29383" ; collection "CORE" ; comment "-" ; family "MADS Box" ; medline "7632923" ; species "3702" ; tax_group "plants" ; type "SELEX" 
PF0069.1	15.4063013735119	SGCGSSAAA	Unknown	; MCS "17.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "E2F-1/DP-2" ; type "phylogenetic" 
PF0096.1	14.0932504690537	YGCANTGCR	Unknown	; MCS "13.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0419.1	13.7523924819353	YAP7	Zipper-Type	; acc "YOL028C" ; collection "CORE" ; family "Leucine Zipper" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" 
MA0193.1	9.65971103980732	Lag1	Helix-Turn-Helix	; acc "Q9W423" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0418.1	11.2313018686508	YAP6	Zipper-Type	; acc "YDR259C" ; collection "CORE" ; family "Leucine Zipper" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
CN0049.1	21.3581245304141	LM49	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "KGTAATTAGCAGCTG" ; medline "17442748" ; species "9606" 
MA0232.1	8.82456873057686	lbl	Helix-Turn-Helix	; acc "P91626" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0219.1	9.02643383861637	ems	Helix-Turn-Helix	; acc "P18488" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0223.1	11.3776904659972	exex	Helix-Turn-Helix	; acc "Q9VSC2" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PF0140.1	13.0753988391757	RNGTGGGC	Unknown	; MCS "10.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PH0037.1	9.63720751970374	Hdx	Helix-Turn-Helix 	; acc "Q14B70" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0170.1	13.5072984828633	YNGTTNNNATT	Unknown	; MCS "9.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
CN0119.1	23.0110085658494	LM119	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "AAACCAATTAGCATC" ; medline "17442748" ; species "9606" 
PF0153.1	16.2848322108467	CTGRYYYNATT	Unknown	; MCS "10.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PF0164.1	16.7009381696348	GCGSCMNTTT	Unknown	; MCS "9.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
CN0020.1	19.9745597835393	LM20	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGACAGCTGTCA" ; medline "17442748" ; species "9606" 
MA0408.1	10.2931677376408	TOS8	Helix-Turn-Helix	; acc "YGL096W" ; collection "CORE" ; family "Homeo" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0071.1	13.1897301896459	RORA_1	Zinc-coordinating	; acc "NP_599023" ; collection "CORE" ; comment "isoform type" ; family "Hormone-nuclear Receptor" ; medline "7926749" ; pazar_tf_id "TF0000047" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
CN0067.1	24.8081709498195	LM67	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WKVAAATGCAATTAAG" ; medline "17442748" ; species "9606" 
MA0014.1	12.4319608285825	Pax5	Helix-Turn-Helix	; acc "Q02650" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "8406007" ; pazar_tf_id "TF0000011" ; species "10090" ; tax_group "vertebrates" ; type "COMPILED" 
CN0167.1	25.5945040691493	LM167	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WYTTGACCTTTTCA" ; medline "17442748" ; species "9606" 
PH0129.1	13.8818157416625	Otx1	Helix-Turn-Helix 	; acc "P80205" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0173.1	12.2941430499133	CG11617	Helix-Turn-Helix	; acc "Q9VPL4" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
CN0011.1	26.0708555289977	LM11	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "ATGGAAATGCTGACAGAMCCTTAA" ; medline "17442748" ; species "9606" 
PH0166.1	13.6801146123483	Six6_2	Helix-Turn-Helix 	; acc "Q9QZ28" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0106.1	26.2394386341062	TP53	Zinc-coordinating	; acc "P04637" ; collection "CORE" ; comment "-" ; family "Loop-Sheet-Helix" ; medline "1588974" ; pazar_tf_id "TF0000077" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
PH0113.1	12.7764029072957	Nkx2-4	Helix-Turn-Helix 	; acc "Q9EQM3" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0029.1	17.9085403297222	Evi1	Zinc-coordinating	; acc "AAI39763" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "8321231" ; pazar_tf_id "TF0000018" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
MA0329.1	7.28114059219166	MBP1	Ig-fold	; acc "YDL056W" ; collection "CORE" ; family "Rel Homology Region" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
CN0206.1	25.6341341723973	LM206	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GAAAACAGTTTGTTCTCT" ; medline "17442748" ; species "9606" 
PH0027.1	13.4366403323443	Emx2	Helix-Turn-Helix 	; acc "Q04744" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
POL009.1	4.13199510752977	DCE_S_II	Unknown	; Description "The DCE consists of three subelements, and each is distinct from the DPE sequence: S_I is CTTC, S_II is CTGT, and S_III is AGC. S_I resides approximately from +6 to +11, S_II from +16 to +21, and S_III from +30 to +34. (Lee et al.). The matrix are built b" ; End relative to TSS "+21" ; Start relative to TSS "+16" ; acc "" ; collection "POLII" ; comment "-" ; medline "16227614" ; species "" 
PB0094.1	11.880861921635	Zfp161	Zinc-coordinating	; acc "Q08376" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0334.1	9.19224435198672	MET32	Zinc-coordinating	; acc "YDR253C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PH0119.1	13.7859408205041	Nkx6-1_2	Helix-Turn-Helix 	; acc "Q99MA9" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PL0015.1	13.3454195705559	hlh-2::hlh-14	Zipper-type	; acc "Q17588,Q09961" ; collection "PBM_HLH" ; comment "heterodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" 
CN0157.1	22.4542695904819	LM157	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGCCTAATTACACA" ; medline "17442748" ; species "9606" 
MA0342.1	9.28104491879008	MSN4	Zinc-coordinating	; acc "YKL062W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0226.1	11.2506365099931	hbn	Helix-Turn-Helix	; acc "Q9W2P8" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PH0077.1	15.0727264465251	Hoxd12	Helix-Turn-Helix 	; acc "P23812" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0287.1	15.6416628564083	CUP2	Zinc-coordinating	; acc "YGL166W" ; collection "CORE" ; family "Copper fist" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" 
CN0226.1	23.1640325414535	LM226	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "AAAGCTTTCTTAATG" ; medline "17442748" ; species "9606" 
MA0100.1	9.88327768496603	Myb	Helix-Turn-Helix	; acc "P06876" ; collection "CORE" ; comment "-" ; family "Myb" ; medline "1861984" ; pazar_tf_id "TF0000072" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
MA0250.1	11.1547935707662	unc-4	Helix-Turn-Helix	; acc "O77215" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PB0023.1	11.6107996418003	Gata6	Zinc-coordinating 	; acc "Q61169" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "GATA  " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0234.1	10.9238153206134	oc	Helix-Turn-Helix	; acc "P22810" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0164.1	12.0283841788908	Nr2e3	Zinc-coordinating	; acc "Q9QXZ7" ; collection "CORE" ; family "Hormone-nuclear Receptor" ; medline "15634773" ; pazar_tf_id "-" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
MA0046.1	15.5481691262781	HNF1A	Helix-Turn-Helix	; acc "ABR09270" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "9047360" ; species "7742" ; tax_group "vertebrates" ; type "COMPILED" 
MA0270.1	11.5093514410114	AFT2	Other	; acc "YPL202C" ; collection "CORE" ; family "Other" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PF0019.1	20.4656414702423	GKCGCNNNNNNNTGAYG	Unknown	; MCS "40.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PF0104.1	18.6852937354041	CCAATNNSNNNGCG	Unknown	; MCS "13.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0412.1	19.2896641173389	UME6	Zinc-coordinating	; acc "YDR207C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" 
CN0025.1	21.0317487734382	LM25	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "AAARGMAATTKCYTTT" ; medline "17442748" ; species "9606" 
CN0154.1	23.4173275673741	LM154	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CAKCTGGATGAAAAATG" ; medline "17442748" ; species "9606" 
MA0180.1	13.4168711191014	Vsx2	Helix-Turn-Helix	; acc "Q9W4B3" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
POL002.1	4.67022136152347	INR	Unknown	; Description "The INR consensus PyPyA(+1)NT/APyPy (Smale, Kadonaga 2003) is characterized by an A at the TSS (+1) and a cytosine at position -1. TFIID specific." ; End relative to TSS "+6" ; Start relative to TSS "-2" ; acc "" ; collection "POLII" ; comment "-" ; medline "2329577" ; species "" 
CN0185.1	23.6543363076089	LM185	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GCTTTGCTTCATTTCAG" ; medline "17442748" ; species "9606" 
MA0322.1	13.2094516970684	INO4	Zipper-Type	; acc "YOL108C" ; collection "CORE" ; family "Helix-Loop-Helix" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
MA0345.1	10.2490608272115	NHP6A	Other Alpha-Helix	; acc "YPR052C" ; collection "CORE" ; family "High Mobility Group (Box)" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
PF0102.1	15.371552469456	ATGGYGGA	Unknown	; MCS "13.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PF0016.1	14.0366116741218	RYTTCCTG	Unknown	; MCS "43.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "C-ETS-2" ; type "phylogenetic" 
MA0006.1	9.53241709191153	Arnt::Ahr	Zipper-Type	; acc "P30561,P53762" ; collection "CORE" ; comment "dimer" ; family "Helix-Loop-Helix" ; medline "7592839" ; pazar_tf_id "TF0000004" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
CN0203.1	23.0812763638508	LM203	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGACTGTGAAATTACAG" ; medline "17442748" ; species "9606" 
MA0113.1	14.7489179581357	NR3C1	Zinc-coordinating	; acc "P04150" ; collection "CORE" ; comment "-" ; family "Hormone-nuclear Receptor" ; medline "15563547" ; species "9606,10090,10116,9031,8022" ; tax_group "vertebrates" ; type "COMPILED" 
MA0042.1	13.1829736117753	FOXI1	Winged Helix-Turn-Helix	; acc "Q12951" ; collection "CORE" ; comment "-" ; family "Forkhead" ; medline "9153225" ; pazar_tf_id "TF0000027" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
PF0036.1	13.0049602985846	RTAAACA	Unknown	; MCS "25.6" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "FREAC-2" ; type "phylogenetic" 
MA0049.1	10.403423261874	hb	Zinc-coordinating	; acc "P05084" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "2507923" ; pazar_tf_id "TF0000031" ; species "7227" ; tax_group "insects" ; type "COMPILED" 
PH0080.1	12.8236376180841	Hoxd8	Helix-Turn-Helix 	; acc "P23463" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0007.1	12.110349846871	TGANTCA	Unknown	; MCS "62.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "Fos" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "AP-1" ; type "phylogenetic" 
PH0065.1	14.0151731223195	Hoxc10	Helix-Turn-Helix 	; acc "P31257" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0300.1	11.6167498282201	GAT1	Zinc-coordinating	; acc "YFL021W" ; collection "CORE" ; family "GATA" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
CN0223.1	26.752426261018	LM223	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "AGMAGTAATTTACTAAATTG" ; medline "17442748" ; species "9606" 
MA0214.1	9.66715523834016	bsh	Helix-Turn-Helix	; acc "Q04787" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PF0149.1	17.0504660691425	YGACNNYACAR	Unknown	; MCS "10.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PF0055.1	12	TGGAAA	Unknown	; MCS "21.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "NF-AT" ; type "phylogenetic" 
CN0117.1	26.4251191691821	LM117	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GATAATTGAGAGTTGAC" ; medline "17442748" ; species "9606" 
MA0263.1	17.9840978364634	ttx-3::ceh-10	Helix-Turn-Helix	; acc "Q94156,P41935" ; collection "CORE" ; comment "dimer" ; family "Homeo" ; medline "15177025 " ; species "6239" ; tax_group "nematodes" ; type "EMSA" 
SA0003.1	9.01616174501847	at_AC_acceptor	Unknown	; acc "" ; collection "SPLICE" ; comment "-" ; description "Non-canonical splice acceptor (3') site (at_AC)" ; medline "15475254" ; species "" 
PF0035.1	13.5107278565549	GCANCTGNY	Unknown	; MCS "25.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "Myf" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "MYOD" ; type "phylogenetic" 
MA0358.1	10.5237644825346	PUT3	Zinc-coordinating	; acc "YKL015W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PH0057.1	12.7859606503488	Hoxb13	Helix-Turn-Helix 	; acc "P70321" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0081.1	12.2349788683527	Tcf3	Other Alpha-Helix 	; acc "Q9Z1J1" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0341.1	8.76523853336397	MSN2	Zinc-coordinating	; acc "YMR037C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PF0018.1	13.8860076750062	TCANNTGAY	Unknown	; MCS "40.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "SREBP-1" ; type "phylogenetic" 
CN0068.1	22.8570135047616	LM68	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WTCATCCAGATGTTTGGY" ; medline "17442748" ; species "9606" 
PF0106.1	18.4740178263056	CCGNMNNTNACG	Unknown	; MCS "12.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0292.1	9.35050814670533	ECM22	Zinc-coordinating	; acc "YLR228C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0433.1	11.6055978609434	YOX1	Helix-Turn-Helix	; acc "YML027W" ; collection "CORE" ; family "Homeo" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
CN0071.1	23.7046410785893	LM71	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGATTAATTGCAAA" ; medline "17442748" ; species "9606" 
CN0189.1	24.709840615613	LM189	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGYTCATTTGAAAGGWAATR" ; medline "17442748" ; species "9606" 
CN0147.1	23.2218643671062	LM147	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "MAGAAATCCATTAACW" ; medline "17442748" ; species "9606" 
PH0022.1	12.8919339838272	Dlx3	Helix-Turn-Helix 	; acc "Q64205" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0187.1	9.27304089364794	Dll	Helix-Turn-Helix	; acc "P20009" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
CN0078.1	22.6061884041905	LM78	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WTTSCAGGAAATTGCW" ; medline "17442748" ; species "9606" 
PB0065.1	10.7473942186786	Sox17	Other Alpha-Helix 	; acc "Q61473" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0146.1	13.0765950923237	Zfx	Zinc-coordinating	; acc "P17012" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "18555785" ; pazar_tf_id "-" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" 
CN0172.1	25.5442989154849	LM172	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "AAATGAAATTCATTTG" ; medline "17442748" ; species "9606" 
CN0024.1	23.0121912261049	LM24	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "DGARAACAGATGGCW" ; medline "17442748" ; species "9606" 
PF0144.1	14.2418901235448	AAANWWTGC	Unknown	; MCS "10.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0222.1	11.3622264394499	exd	Helix-Turn-Helix	; acc "P40427" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PH0168.1	13.6430312286604	Hnf1b	Helix-Turn-Helix 	; acc "P27889" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0050.1	12.3831873903492	Hoxa3	Helix-Turn-Helix 	; acc "P02831" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0123.1	24.9212641781074	LM123	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WGCTGTCAKTTKTMATK" ; medline "17442748" ; species "9606" 
MA0065.1	23.4488895332387	PPARG::RXRA	Zinc-coordinating	; acc "P37231,P19793" ; collection "CORE" ; comment "Heterodimer between PPARG and RXRA" ; family "Hormone-nuclear Receptor" ; medline "11139380" ; pazar_tf_id "TF0000041" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
MA0374.1	7.97832421428651	RSC3	Zinc-coordinating	; acc "YDR303C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PF0112.1	16.8667694111057	KTGGYRSGAA	Unknown	; MCS "12.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PF0029.1	13.0088940575263	CTTTAAR	Unknown	; MCS "30.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PH0086.1	12.4011657952795	Irx5	Helix-Turn-Helix 	; acc "Q9JKQ4" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0116.1	23.7887526952949	LM116	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WWNAAGHTGAAAATTGCT" ; medline "17442748" ; species "9606" 
MA0104.1	10.4430512056894	Mycn	Zipper-Type	; acc "P03966" ; collection "CORE" ; comment "-" ; family "Helix-Loop-Helix" ; medline "1594445" ; pazar_tf_id "TF0000075" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
PH0051.1	13.7340919310298	Hoxa4	Helix-Turn-Helix 	; acc "P06798" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0008.1	18.0536165315128	TMTCGCGANR	Unknown	; MCS "55.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PB0004.1	14.6561787543833	Atf1	Zipper-Type 	; acc "P81269" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Leucine Zipper " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0092.1	9.04684404277308	Zfp105	Zinc-coordinating	; acc "Q3UHV1" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0019.1	15.4959221906276	Foxl1	Winged Helix-Turn-Helix 	; acc "Q64731" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Forkhead  " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0435.1	16.7110034522709	YPR015C	Zinc-coordinating	; acc "YPR015C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
CN0229.1	23.8220883047563	LM229	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TTTCCATCATAAATC" ; medline "17442748" ; species "9606" 
PF0109.1	16.3138527051093	YGTCCTTGR	Unknown	; MCS "12.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
CN0015.1	21.5544935711601	LM15	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "MATTTGCATGCAAATGA" ; medline "17442748" ; species "9606" 
PB0066.1	9.97179430311051	Sox18	Other Alpha-Helix 	; acc "P43680" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0391.1	11.3895080983534	STB4	Zinc-coordinating	; acc "YMR019W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PH0140.1	15.6549487960567	Pknox1	Helix-Turn-Helix 	; acc "O70477" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0068.1	9.84657738916937	Sox21	Other Alpha-Helix 	; acc "Q811W0" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0258.1	13.6176585887245	ESR2	Zinc-coordinating	; acc "Q92731" ; collection "CORE" ; comment "-" ; family "Hormone-nuclear Receptor" ; medline "18272478" ; species "9606" ; tax_group "vertebrates" ; type "ChIP-chip" 
MA0243.1	7.9894000586356	sd	Helix-Turn-Helix	; acc "P30052" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "15572468" ; species "7227" ; tax_group "insects" ; type "DNaseI footprinting" 
PH0018.1	6.89155928111887	Dbx1	Helix-Turn-Helix 	; acc "P52950" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0047.1	23.731873920837	LM47	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "AGAGTGCCACCTACTGAAT" ; medline "17442748" ; species "9606" 
PF0100.1	17.9373932225313	CRGAARNNNNCGA	Unknown	; MCS "13.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
CN0007.1	18.3654401914699	LM7	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "NNNCCAGCAGATGGCGCTRT" ; medline "17442748" ; species "9606" 
MA0084.1	9.193014653455	SRY	Other Alpha-Helix	; acc "Q05066" ; collection "CORE" ; comment "-" ; family "High Mobility Group (Box)" ; medline "8190643" ; pazar_tf_id "TF0000059" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
PF0024.1	14.3109738838275	GGGAGGRR	Unknown	; MCS "33.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "MAZ" ; type "phylogenetic" 
MA0165.1	9.59994164678813	Abd-B	Helix-Turn-Helix	; acc "P09087" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0160.1	10.1646684725876	NR4A2	Zinc-coordinating	; acc "P43354" ; collection "CORE" ; comment "Annotations from PAZAR NR4A2_MOUSE + NR4A2_RAT + NR4A2_HUMAN (TF0000135, TF0000153, TF0000157) in the pleiades genes project." ; family "Hormone-nuclear Receptor" ; medline "17916232" ; pazar_tf_id "TF0000135" ; species "10090,10116,9606" ; tax_group "vertebrates" ; type "COMPILED" 
PL0003.1	11.2833069515575	hlh-2::cnd-1	Zipper-type	; acc "Q17588,P46581" ; collection "PBM_HLH" ; comment "heterodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" 
CN0139.1	23.9425126253881	LM139	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "ACTGACCTACTTTCC" ; medline "17442748" ; species "9606" 
CN0191.1	23.859667940978	LM191	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "ATCCATTTGTTGCCATGGT" ; medline "17442748" ; species "9606" 
CN0097.1	23.806312505803	LM97	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CATWAAGCTGTCAG" ; medline "17442748" ; species "9606" 
PH0040.1	12.8668337639977	Hmbox1	Helix-Turn-Helix 	; acc "Q8BJA3" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0107.1	15.4395660004642	RTTTNNNYTGGM	Unknown	; MCS "12.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0047.2	13.2676176116311	Foxa2	Winged Helix-Turn-Helix	; acc "P35583" ; collection "CORE" ; comment "-" ; family "Forkhead" ; medline "19553195 " ; pazar_tf_id "TF0000029" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" 
PF0042.1	13.0127592283486	TGACATY	Unknown	; MCS "23.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PF0146.1	14.0696097674866	RRCCGTTA	Unknown	; MCS "10.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0285.1	8.316784790192	CRZ1	Zinc-coordinating	; acc "YNL027W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PF0039.1	16.8939815609571	TCCCRNNRTGC	Unknown	; MCS "24.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
CN0177.1	23.4922627974238	LM177	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTTTGGCTTCAGACCAAAT" ; medline "17442748" ; species "9606" 
PH0029.1	12.9952610733464	En2	Helix-Turn-Helix 	; acc "P09066" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PL0009.1	13.9863558396788	hlh-26	Zipper-type	; acc "Q18053" ; collection "PBM_HLH" ; comment "homodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" 
PB0025.1	12.2269963103213	Glis2	Zinc-coordinating 	; acc "Q8R4X9" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0369.1	20.6218830256623	RLM1	Other Alpha-Helix	; acc "YPL089C" ; collection "CORE" ; family "MADS Box" ; medline "10487868" ; species "4932" ; tax_group "fungi" ; type "COMPILED" 
PH0132.1	12.1600000551455	Pax6	Helix-Turn-Helix 	; acc "P63015" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0082.1	12.3886856970394	squamosa	Other Alpha-Helix	; acc "CAA45228" ; collection "CORE" ; comment "-" ; family "MADS Box" ; medline "9826749" ; species "4151" ; tax_group "plants" ; type "SELEX" 
MA0064.1	8.5086853429636	PBF	Zinc-coordinating	; acc "O24463" ; collection "CORE" ; comment "-" ; family "Dof" ; medline "10074718" ; species "4577" ; tax_group "plants" ; type "SELEX" 
PF0105.1	18.6154406563166	ACTWSNACTNY	Unknown	; MCS "13.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0157.1	11.7336527653393	FOXO3	Winged Helix-Turn-Helix	; acc "O43524" ; collection "CORE" ; comment "Annotations from PAZAR FOXO3_MOUSE + FOXO3_HUMAN (TF0000811, TF0000812) in the TFe project." ; family "Forkhead" ; medline "17916232" ; pazar_tf_id "-" ; species "10090,9606" ; tax_group "vertebrates" ; type "COMPILED" 
MA0271.1	9.09168920580179	ARG80	Other Alpha-Helix	; acc "YMR042W" ; collection "CORE" ; family "MADS Box" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
CN0118.1	23.4315347136407	LM118	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WSATTTWCWGKAAATSW" ; medline "17442748" ; species "9606" 
PH0007.1	11.7420127534325	Barx1	Helix-Turn-Helix 	; acc "Q9ER42" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0026.1	14.0259308050782	TTAYRTAA	Unknown	; MCS "32.6" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "NFIL3" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "E4BP4" ; type "phylogenetic" 
MA0053.1	8.62904940554533	MNB1A	Zinc-coordinating	; acc "P38564" ; collection "CORE" ; comment "-" ; family "Dof" ; medline "10074718" ; species "4577" ; tax_group "plants" ; type "SELEX" 
MA0309.1	10.2189454478092	GZF3	Zinc-coordinating	; acc "YJL110C" ; collection "CORE" ; family "GATA" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
CN0030.1	23.4560582405832	LM30	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTTTGAAATGTCAAW" ; medline "17442748" ; species "9606" 
MA0181.1	10.5023614963848	Vsx1	Helix-Turn-Helix	; acc "Q5U1D9" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PB0008.1	11.5565233062986	E2F2	Winged Helix-Turn-Helix 	; acc "P56931" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Transcription Factor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0208.1	21.6170213397895	LM208	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGTGAAATGAGTTGG" ; medline "17442748" ; species "9606" 
CN0108.1	25.0499589793009	LM108	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "YSAATTATCCAGATAATTGCY" ; medline "17442748" ; species "9606" 
MA0289.1	10.9849382468964	DAL80	Zinc-coordinating	; acc "YKR034W" ; collection "CORE" ; family "GATA" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PB0032.1	10.1361640873387	Irf3	Winged Helix-Turn-Helix 	; acc "P70671" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Interferon Regulatory Factor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0199.1	9.08017198664068	Optix	Helix-Turn-Helix	; acc "Q95RW8" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PF0020.1	13.0195695082253	GTGACGY	Unknown	; MCS "38.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "CREB1" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "E4F1" ; type "phylogenetic" 
MA0004.1	10.9916749479967	Arnt	Zipper-Type	; acc "P53762" ; collection "CORE" ; comment "-" ; family "Helix-Loop-Helix" ; medline "7592839" ; pazar_tf_id "TF0000003" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
PF0137.1	15.6273819419734	GAANYNYGACNY	Unknown	; MCS "11.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PF0022.1	13.2772616543157	TGCGCANK	Unknown	; MCS "37.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0402.1	11.3557437784715	SWI5	Zinc-coordinating	; acc "YDR146C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PF0002.1	12	CACGTG	Unknown	; MCS "85.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "MYC" ; type "phylogenetic" 
MA0010.1	12.6171586319072	br_Z1	Zinc-coordinating	; acc "Q01295-1" ; collection "CORE" ; comment "Different splice forms affect DNA binding: four matrices" ; family "BetaBetaAlpha-zinc finger" ; medline "8062827" ; pazar_tf_id "TF0000007" ; species "7227" ; tax_group "insects" ; type "COMPILED" 
POL003.1	11.5380830281189	GC-box	Unknown	; Description "The GC-box is recognised by transcription factor Sp1 and typically occurs in housekeeping genes (Kadonaga et al. 1986). " ; End relative to TSS "-157 to +8" ; Start relative to TSS "-170 to -6" ; acc "" ; collection "POLII" ; comment "-" ; medline "2329577" ; species "" 
MA0279.1	15.6622068499338	CAD1	Zipper-Type	; acc "YDR423C" ; collection "CORE" ; family "Leucine Zipper" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" 
PH0015.1	14.610038513781	Crx	Helix-Turn-Helix 	; acc "O54751" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0230.1	11.6941782748841	lab	Helix-Turn-Helix	; acc "P10105" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0150.1	14.3935983450542	NFE2L2	Zipper-Type	; acc "Q16236" ; collection "CORE" ; comment "Annotations from PAZAR NFE2L2(NRF2) in the AREs project (TF0000699)." ; family "Leucine Zipper" ; medline "17916232" ; pazar_tf_id "TF0000699" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" 
MA0013.1	11.6009123934947	br_Z4	Zinc-coordinating	; acc "Q24206" ; collection "CORE" ; comment "Different splice forms affect DNA binding: four matrices" ; family "BetaBetaAlpha-zinc finger" ; medline "8062827" ; pazar_tf_id "TF0000010" ; species "7227" ; tax_group "insects" ; type "COMPILED" 
CN0213.1	25.3025047912525	LM213	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTTTGAGTTCCTTGGAAGAA" ; medline "17442748" ; species "9606" 
PB0102.1	10.1413371458925	Zic3	Zinc-coordinating 	; acc "Q62521" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0039.1	7.23339319085871	Klf4	Zinc-coordinating	; acc "Q60793" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "9443972" ; pazar_tf_id "TF0000026" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
PB0075.1	14.3898676344356	Sp4	Zinc-coordinating 	; acc "Q62445" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0045.1	23.4244082454306	LM45	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GCTAATTGGATTTG" ; medline "17442748" ; species "9606" 
MA0259.1	9.73982400956926	HIF1A::ARNT	Zipper-Type	; acc "EAW80806,EAW53510" ; collection "CORE" ; comment "dimer between HIF1A and ARNT" ; family "Helix-Loop-Helix" ; medline "16234508" ; species "9606,10090,10117,9986" ; tax_group "vertebrates" ; type "COMPILED" 
CN0102.1	22.3017907010853	LM102	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TCAAAGYACTTTWCAARM" ; medline "17442748" ; species "9606" 
MA0302.1	9.55934046251425	GAT4	Zinc-coordinating	; acc "YIR013C" ; collection "CORE" ; family "GATA" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PH0108.1	14.450268088113	Msx3	Helix-Turn-Helix 	; acc "P70354" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0046.1	14.3841923888905	WTTGKCTG	Unknown	; MCS "23.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
CN0008.1	20.9642817346103	LM8	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "MATGAATWATTCATR" ; medline "17442748" ; species "9606" 
PB0051.1	11.4222358268488	Plagl1	Zinc-coordinating 	; acc "O35745" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0085.1	23.5160140257339	LM85	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WKSTTTTCATTAAAGM" ; medline "17442748" ; species "9606" 
MA0436.1	10.7653362127042	YPR022C	Zinc-coordinating	; acc "YPR022C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0213.1	10.9161976221813	brk	Helix-Turn-Helix	; acc "Q9XTN4" ; collection "CORE" ; family "Brinker" ; medline "15572468" ; species "7227" ; tax_group "insects" ; type "DNaseI footprinting" 
MA0108.2	10.0863285219951	TBP	Beta-sheet	; acc "" ; collection "CORE" ; comment "column 7 error fixed in version 2 " ; family "TATA box-binding" ; medline "2329577" ; species "" ; tax_group "vertebrates" 
PF0030.1	15.2846884255224	YGCGYRCGC	Unknown	; MCS "30.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PF0081.1	19.6535618616035	CGGAARNGGCNG	Unknown	; MCS "15.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0097.1	19.8816971076341	bZIP911	Zipper-Type	; acc "CAA74023" ; collection "CORE" ; comment "-" ; family "Leucine Zipper" ; medline "9680995" ; species "4151" ; tax_group "plants" ; type "SELEX" 
MA0303.1	13.4778660328311	GCN4	Zipper-Type	; acc "YEL009C" ; collection "CORE" ; family "Leucine Zipper" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
MA0257.1	10.0973916509732	zen2	Helix-Turn-Helix	; acc "P09090" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
POL001.1	20.9565457332953	MTE	Unknown	; Description "The matrix is made of 9 sequences that have been tested positively as sites of transcription initiation in vivo." ; End relative to TSS "+33" ; Start relative to TSS "+15" ; acc "" ; collection "POLII" ; comment "-" ; medline "15231738" ; species "7227" 
MA0096.1	12.5511843642748	bZIP910	Zipper-Type	; acc "CAA74022" ; collection "CORE" ; comment "-" ; family "Leucine Zipper" ; medline "9680995" ; species "4151" ; tax_group "plants" ; type "SELEX" 
MA0020.1	8.6241100995044	Dof2	Zinc-coordinating	; acc "Q41800" ; collection "CORE" ; comment "-" ; family "Dof" ; medline "10074718" ; species "4577" ; tax_group "plants" ; type "SELEX" 
MA0381.1	7.95642480202349	SKN7	Winged Helix-Turn-Helix	; acc "YHR206W" ; collection "CORE" ; family "Transcription Factor" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PF0126.1	16.6746705013525	WYAAANNRNNNGCG	Unknown	; MCS "11.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
CN0002.1	18.9915557353914	LM2	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "YNRCCACYAGATGGCAGYM" ; medline "17442748" ; species "9606" 
CN0038.1	23.2143856409627	LM38	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GCAAATTAGCAGCT" ; medline "17442748" ; species "9606" 
MA0138.2	23.133898399507	REST	Zinc-coordinating	; acc "NP_005603" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "17540862 " ; pazar_tf_id "TF0000830" ; species "9606" ; tax_group "vertebrates" ; type "Chip-seq" 
CN0041.1	21.6262629089616	LM41	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTTTGAAATGCTAATK" ; medline "17442748" ; species "9606" 
PL0001.1	12.2114602244847	hlh-11	Zipper-type	; acc "P34474" ; collection "PBM_HLH" ; comment "homodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" 
PB0033.1	13.0235716814011	Irf4	Winged Helix-Turn-Helix 	; acc "Q64287" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Interferon Regulatory Factor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0165.1	22.8059318311726	LM165	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GATTTCCTGTTGTG" ; medline "17442748" ; species "9606" 
PF0115.1	15.9330467030515	YRTCANNRCGC	Unknown	; MCS "12.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PH0137.1	14.2397248928712	Pitx1	Helix-Turn-Helix 	; acc "P70314" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0197.1	9.51009283285792	Oct	Helix-Turn-Helix	; acc "-" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PF0132.1	14.298652112109	TCCATTKW	Unknown	; MCS "11.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PH0005.1	13.6408451130939	Barhl1	Helix-Turn-Helix 	; acc "P63157" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0005.1	24.1075170284629	LM5	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TCCCATTARYRTTAATGGGA" ; medline "17442748" ; species "9606" 
PF0165.1	15.9848802580746	CCAWNWWNNNGGC	Unknown	; MCS "9.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PH0059.1	12.8262885328954	Hoxb4	Helix-Turn-Helix 	; acc "P10284" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0060.1	21.994425588456	LM60	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "YWYATGAATATTCATRWR" ; medline "17442748" ; species "9606" 
CN0156.1	22.5724021755861	LM156	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "SCTTTGTAAACAAG" ; medline "17442748" ; species "9606" 
PF0077.1	14.1039821338926	AAAYRNCTG	Unknown	; MCS "16.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
CN0225.1	23.388903549835	LM225	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTGTGGAAAATCTGA" ; medline "17442748" ; species "9606" 
CN0187.1	24.8257961232955	LM187	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTTTGATCTTTCATT" ; medline "17442748" ; species "9606" 
PH0025.1	12.988854062741	Dmbx1	Helix-Turn-Helix 	; acc "Q91ZK4" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0015.1	12	CAGCTG	Unknown	; MCS "43.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "NHLH1" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "AP-4" ; type "phylogenetic" 
CN0198.1	24.3818001742724	LM198	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "MTGAACTTTGTTTGAACT" ; medline "17442748" ; species "9606" 
PH0013.1	13.3684702495438	Cdx2	Helix-Turn-Helix 	; acc "P43241" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0280.1	8.78275239590496	CAT8	Zinc-coordinating	; acc "YMR280C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PH0024.1	10.9140776889322	Dlx5	Helix-Turn-Helix 	; acc "P70396" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0383.1	9.33871783570431	SMP1	Other Alpha-Helix	; acc "YBR182C" ; collection "CORE" ; family "MADS Box" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
CN0174.1	23.2717790086553	LM174	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "AGCTGCCAAAAATC" ; medline "17442748" ; species "9606" 
PF0025.1	13.0232859340055	TGACCTY	Unknown	; MCS "33.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "ESRRA" ; type "phylogenetic" 
PH0120.1	12.4532706753644	Nkx6-3	Helix-Turn-Helix 	; acc "Q9D2W8" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0060.1	12.8265429646846	Sox11	Other Alpha-Helix 	; acc "Q04889" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0162.1	14.4555832078878	Egr1	Zinc-coordinating	; acc "P08046" ; collection "CORE" ; comment "aka Zif268" ; family "BetaBetaAlpha-zinc finger" ; medline "16041365" ; pazar_tf_id "TF0000345" ; species "10090" ; tax_group "vertebrates" ; type "bacterial 1-hybrid" 
PB0074.1	9.54729512013954	Sp100	Other Alpha-Helix	; acc "O35892" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Sand" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0145.1	15.0672258374188	Pou2f3	Helix-Turn-Helix 	; acc "P31362" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0027.1	6.42106534259983	En1	Helix-Turn-Helix	; acc "P09065" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "8096059" ; pazar_tf_id "TF0000016" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
MA0349.1	10.3358376861698	OPI1	Zipper-Type	; acc "YHL020C" ; collection "CORE" ; family "Leucine Zipper" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
MA0119.1	19.6648726674762	TLX1::NFIC	Helix-Turn-Helix::Other	; acc "P31314,NP_995315.1" ; collection "CORE" ; comment "heterodimer between TLX1 and NFIC" ; family "Homeo::Nuclear Factor I-CCAAT-bindingTranscription Factor" ; medline "10327073" ; pazar_tf_id "TF0000083" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
MA0099.1	10.6698488649404	Fos	Zipper-Type	; acc "P01101" ; collection "CORE" ; comment "-" ; family "Leucine Zipper" ; medline "2243767" ; pazar_tf_id "TF0000071" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
MA0051.1	21.1344205827808	IRF2	Winged Helix-Turn-Helix	; acc "P14316" ; collection "CORE" ; comment "-" ; family "Interferon Regulatory Factor" ; medline "7687740" ; pazar_tf_id "TF0000033" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
MA0130.1	8.9580088251372	ZNF354C	Zinc-coordinating	; acc "Q86Y25" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "15555547" ; pazar_tf_id "TF0000822" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
MA0201.1	12.6373054171588	Ptx1	Helix-Turn-Helix	; acc "O18400" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0081.1	9.06007121381261	SPIB	Winged Helix-Turn-Helix	; acc "Q01892" ; collection "CORE" ; comment "-" ; family "Ets" ; medline "7624145" ; pazar_tf_id "TF0000057" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
MA0236.1	10.1240751672098	otp	Helix-Turn-Helix	; acc "P56672" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PH0157.1	12.0004438972684	Rhox11_1	Helix-Turn-Helix 	; acc "Q810N8" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0081.1	26.3244614080236	LM81	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GGTAATTACATTCTGCYT" ; medline "17442748" ; species "9606" 
PH0090.1	12.3273781330664	Lbx2	Helix-Turn-Helix 	; acc "Q32M12" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0083.1	17.9647716467558	SRF	Other Alpha-Helix	; acc "P11831" ; collection "CORE" ; comment "-" ; family "MADS Box" ; medline "2243767" ; pazar_tf_id "TF0000058" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
PH0017.1	10.2334494194658	Cux1_2	Helix-Turn-Helix 	; acc "P70403" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
POL006.1	7.65052498791428	BREu	Unknown	; Description "Core promoter element that is recognised by TFIIB located uptream of the TATA-box." ; End relative to TSS "-32" ; Start relative to TSS "-39" ; acc "" ; collection "POLII" ; comment "-" ; medline "9420329" ; species "" 
PF0127.1	14.0839692050207	WWTAAGGC	Unknown	; MCS "11.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0254.1	8.16728374802456	vvl	Helix-Turn-Helix	; acc "P16241" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "15572468" ; species "7227" ; tax_group "insects" ; type "DNaseI footprinting" 
PH0012.1	12.8481243816903	Cdx1	Helix-Turn-Helix 	; acc "P18111" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0100.1	23.6357721369821	LM100	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "ACTGAGCATGCTCAG" ; medline "17442748" ; species "9606" 
MF0011.1	5.33180767133444	HMG class	HMG	; acc "" ; collection "FAM" ; comment "-" ; included_models "MA0044,MA0045,MA0077,MA0078,MA0084,MA0087" ; medline "15066426" ; species "" ; type "METAMODEL" 
MA0353.1	16	PDR3	Zinc-coordinating	; acc "YBL005W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
CN0186.1	22.1134208863855	LM186	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GGCAGTAATTTTCC" ; medline "17442748" ; species "9606" 
PF0166.1	18.1947520491882	YNTTTNNNANGCARM	Unknown	; MCS "9.6" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PF0123.1	17.6377292086284	GGCNNMSMYNTTG	Unknown	; MCS "11.6" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
CN0040.1	21.8880124085836	LM40	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TCCCATTGACTTCAAWGGGAGYT" ; medline "17442748" ; species "9606" 
PL0017.1	14.2187702062255	hlh-2::hlh-10	Zipper-type	; acc "Q17588,Q23579" ; collection "PBM_HLH" ; comment "heterodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" 
MA0313.1	8.22127924740869	HAP2	Other Alpha-Helix	; acc "YGL237C" ; collection "CORE" ; family "NF-Y CCAAT-Binding Protein" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" 
CN0018.1	23.7515789282212	LM18	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "ATTTGCATNTSATTTGCAT" ; medline "17442748" ; species "9606" 
PB0014.1	13.2461919125153	Esrra	Zinc-coordinating 	; acc "O08580" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Hormone-nuclear Receptor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
SD0001.1	8.12219678199792	at_AC_acceptor	Unknown	; acc "" ; collection "SPLICE" ; comment "-" ; description "Non-canonical splice acceptor (3') site (at_AC)" ; medline "15475254" ; species "" 
PB0018.1	15.2680978446124	Foxk1	Winged Helix-Turn-Helix 	; acc "P42128" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Forkhead  " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0130.1	15.1978017393408	CCCNNGGGAR	Unknown	; MCS "11.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "OLF-1" ; type "phylogenetic" 
PB0048.1	13.0815289826598	Nr2f2	Zinc-coordinating 	; acc "P43135" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Hormone-nuclear Receptor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0162.1	15.0714106573294	Six2	Helix-Turn-Helix 	; acc "Q62232" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0067.1	14.9798187076105	Hoxc12	Helix-Turn-Helix 	; acc "P31313" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0274.1	8.9865976258638	ARR1	Zipper-Type	; acc "YPR199C" ; collection "CORE" ; family "Leucine Zipper" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
PH0071.1	11.1385213378189	Hoxc6	Helix-Turn-Helix 	; acc "P10629" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0169.1	23.3541322578337	LM169	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TTCCCAGCTGTTGC" ; medline "17442748" ; species "9606" 
PH0054.1	10.2241949165341	Hoxa7_1	Helix-Turn-Helix 	; acc "P02830" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0011.1	13.6326800080858	Alx1_2	Helix-Turn-Helix 	; acc "Q8C8B0" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0039.1	20.8799007782519	LM39	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "KNKGTYTCCTAGGAAACM" ; medline "17442748" ; species "9606" 
MA0252.1	10.25	vis	Helix-Turn-Helix	; acc "A1Z913" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0002.1	11.6956693818896	RUNX1	Ig-fold	; acc "Q01196" ; collection "CORE" ; comment "Matrix changed since last release: removal of primers and sites overlapping primers" ; family "Runt" ; medline "8413232" ; pazar_tf_id "TF0000001" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
MA0090.1	15.6777724709562	TEAD1	Helix-Turn-Helix	; acc "P28347" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "9571041" ; pazar_tf_id "TF0000064" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" 
PF0092.1	13.0249047188108	TGCTGAY	Unknown	; MCS "14.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "MafB" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0141.1	12.8061908151661	Esrrb	Zinc-coordinating      	; acc "Q61539" ; collection "CORE" ; comment "-" ; family "Hormone-nuclear Receptor" ; medline "18555785           " ; pazar_tf_id "-" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" 
PF0017.1	12	AACTTT	Unknown	; MCS "42.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "NR2F1" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "IRF1(*)" ; type "phylogenetic" 
PB0056.1	12.2459985391191	Rxra	Zinc-coordinating 	; acc "P28700" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Hormone-nuclear Receptor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0141.1	16.0536657128652	TTCNRGNNNNTTC	Unknown	; MCS "10.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "HSF" ; type "phylogenetic" 
MA0403.1	8.80299362713321	TBF1	Helix-Turn-Helix	; acc "YPL128C" ; collection "CORE" ; family "Myb" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0040.1	14.0702573602851	Foxq1	Winged Helix-Turn-Helix	; acc "Q63244" ; collection "CORE" ; comment "-" ; family "Forkhead" ; medline "8139574" ; species "10116" ; tax_group "vertebrates" ; type "SELEX" 
PF0063.1	18.0595027713403	AAGWWRNYGGC	Unknown	; MCS "19.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
CN0163.1	23.4620113749556	LM163	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TCATTTCCTCCTAATTGNY" ; medline "17442748" ; species "9606" 
CN0054.1	21.1215454846814	LM54	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "YMATTCATCACTGTCAR" ; medline "17442748" ; species "9606" 
MA0228.1	11.3261482141537	ind	Helix-Turn-Helix	; acc "O96620" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0221.1	9.31751114395201	eve	Helix-Turn-Helix	; acc "P06602" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
CN0221.1	25.6857491206426	LM221	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGGCTGKCTTCCCAG" ; medline "17442748" ; species "9606" 
MA0118.1	7.46607328520911	Macho-1	Zinc-coordinating	; acc "Q9GRA5" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "15661650" ; species "7729" ; tax_group "urochordates" ; type "SELEX" 
PH0009.1	11.2328260922271	Bsx	Helix-Turn-Helix 	; acc "Q810B3" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0262.1	17.2157474927534	mab-3	Zinc-coordinating	; acc "O18214" ; collection "CORE" ; comment "-" ; family "DM" ; medline "9927589" ; species "6239" ; tax_group "nematodes" ; type "EMSA" 
CN0072.1	24.3845134874948	LM72	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "NATGCYTCATTAAMY" ; medline "17442748" ; species "9606" 
PH0105.1	13.997803943207	Meis3	Helix-Turn-Helix 	; acc "P97368" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0033.1	12.9328767138232	Gbx1	Helix-Turn-Helix 	; acc "P82976" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0003.1	11.2173795924231	Ascl2	Zipper-Type 	; acc "O35885" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Helix-Loop-Helix " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MF0002.1	10.786011975578	bZIP CREB/G-box-like subclass	bZIP	; acc "" ; collection "FAM" ; comment "-" ; included_models "MA0018,MA0089,MA0096,MA0097" ; medline "15066426" ; species "" ; type "METAMODEL" 
MA0117.1	6.76893921374478	Mafb	Zipper-Type	; acc "P54842" ; collection "CORE" ; comment "-" ; family "Leucine Zipper" ; medline "9571165" ; pazar_tf_id "TF0000082" ; species "10116" ; tax_group "vertebrates" ; type "SELEX" 
PF0156.1	19.114358671457	YRCCAKNNGNCGC	Unknown	; MCS "10.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MF0001.1	8.99242242623466	ETS class	ETS	; acc "" ; collection "FAM" ; comment "-" ; included_models "MA0026,MA0028,MA0062,MA0076,MA0080,MA0081,MA0098" ; medline "15066426" ; species "" ; type "METAMODEL" 
CN0207.1	26.4182429717377	LM207	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WKRMYTTTKGCMAAAAKYMA" ; medline "17442748" ; species "9606" 
MA0268.1	8.4724520365976	ADR1	Zinc-coordinating	; acc "YDR216W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0247.1	12.4251201932675	tin	Helix-Turn-Helix	; acc "P22711" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PH0126.1	14.2919356397703	Obox6	Helix-Turn-Helix 	; acc "Q8VHG3" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0021.1	14.6093347426636	Gata3	Zinc-coordinating 	; acc "P23772" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "GATA  " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0124.1	15.5709411286776	Obox5_1	Helix-Turn-Helix 	; acc "Q7TPZ5" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0043.1	13.9498796629034	Hmx3	Helix-Turn-Helix 	; acc "P42581" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0178.1	20.7181026094443	LM178	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "NNMWTTCATTTTCCAAAGCA" ; medline "17442748" ; species "9606" 
MA0365.1	11.2870164681831	RFX1	Winged Helix-Turn-Helix	; acc "YLR176C" ; collection "CORE" ; family "RFX" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0326.1	13.2289099435869	MAC1	Zinc-coordinating	; acc "YMR021C" ; collection "CORE" ; family "Copper fist" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" 
PF0037.1	17.1519912622406	GTTRYCATRR	Unknown	; MCS "25.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0105.1	15.6269629573419	NFKB1	Ig-fold	; acc "P19838" ; collection "CORE" ; comment "-" ; family "Rel Homology Region" ; medline "1406630" ; pazar_tf_id "TF0000076" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
MA0123.1	9.74035932391708	abi4	Beta-Hairpin-Ribbon	; acc "Q8L7W9" ; collection "CORE" ; comment "-" ; family "AP2 MBD-like" ; medline "12368505" ; species "4577" ; tax_group "plants" ; type "SELEX" 
PF0059.1	17.0423594843022	WCTCNATGGY	Unknown	; MCS "19.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PH0170.1	15.8860720342715	Tgif2	Helix-Turn-Helix 	; acc "Q8C0Y1" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0347.1	14.1918208509896	NRG1	Zinc-coordinating	; acc "YDR043C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
CN0106.1	20.5741289489696	LM106	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGCTGASTCAGCA" ; medline "17442748" ; species "9606" 
MA0380.1	8.68273371541995	SIP4	Zinc-coordinating	; acc "YJL089W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0088.1	17.5411729665119	znf143	Zinc-coordinating	; acc "Q91853" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "9009278" ; species "8355" ; tax_group "vertebrates" ; type "COMPILED" 
CN0128.1	25.6746722574165	LM128	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGCCAAGTTTCAGCCTGGAG" ; medline "17442748" ; species "9606" 
PF0066.1	18.6898753297241	RACTNNRTTTNC	Unknown	; MCS "18.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
CN0103.1	20.4275000237908	LM103	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "AAATGTCACCATCTGKW" ; medline "17442748" ; species "9606" 
CN0012.1	24.883970111514	LM12	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "RTGGCCTGAAAGAGTTAATGCW" ; medline "17442748" ; species "9606" 
MA0169.1	10.4181530613641	B-H2	Helix-Turn-Helix	; acc "Q24256" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PF0031.1	14.5333591848674	GGGYGTGNY	Unknown	; MCS "30.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0396.1	11.1636679090966	STP3	Zinc-coordinating	; acc "YLR375W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PF0004.1	20.622995901164	ACTAYRNNNCCCR	Unknown	; MCS "69.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
POL004.1	10.7511552886618	CCAAT-box	Unknown	; Description "The CCAAT-box is recognised by the CCAAT-binding proteins NY-I (Dorn et al. 1987), NF-I and C/EBP." ; End relative to TSS "-208 to -52" ; Start relative to TSS "-219 to -64" ; acc "" ; collection "POLII" ; comment "-" ; medline "2329577" ; species "" 
PH0142.1	13.0467860362069	Pou1f1	Helix-Turn-Helix 	; acc "Q00286" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0328.1	14.6254506684601	MATALPHA2	Helix-Turn-Helix	; acc "YCL067C" ; collection "CORE" ; family "Homeo" ; medline "10487868" ; species "4932" ; tax_group "fungi" ; type "COMPILED" 
MA0048.1	14.1315572207903	NHLH1	Zipper-Type	; acc "Q02575" ; collection "CORE" ; comment "-" ; family "Helix-Loop-Helix" ; medline "8289804" ; pazar_tf_id "TF0000030" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
CN0195.1	23.598578655561	LM195	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TTTCCTTTCCAGCTG" ; medline "17442748" ; species "9606" 
CN0171.1	22.8012682354102	LM171	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "RTGTTAATGACTTC" ; medline "17442748" ; species "9606" 
CN0079.1	22.3462482682605	LM79	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TKCWAATGCAAATCAGNY" ; medline "17442748" ; species "9606" 
PF0012.1	12	CAGGTG	Unknown	; MCS "47.6" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "ESR1" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "E12" ; type "phylogenetic" 
MA0167.1	10.2270602668637	Awh	Helix-Turn-Helix	; acc "Q8IRC7" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PF0145.1	14.0417686728717	YKACATTT	Unknown	; MCS "10.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0056.1	8.58551320253218	MZF1_1-4	Zinc-coordinating	; acc "P28698" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "8114711" ; pazar_tf_id "TF0000035" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
PB0052.1	13.6364733478738	Rara	Zinc-coordinating 	; acc "P11416" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Hormone-nuclear Receptor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0080.1	7.21720396462768	SPI1	Winged Helix-Turn-Helix	; acc "P17947" ; collection "CORE" ; comment "-" ; family "Ets" ; medline "7624145" ; pazar_tf_id "TF0000056" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
CN0017.1	22.5463270106005	LM17	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WNWRCATCTGRTTTGCATTW" ; medline "17442748" ; species "9606" 
MA0421.1	16.3156076910341	YDR026C	Helix-Turn-Helix	; acc "YDR026C" ; collection "CORE" ; family "Myb" ; medline "17130146" ; species "4932" ; tax_group "fungi" ; type "COMPILED" 
MA0045.1	10.3410853256607	HMG-I/Y	Other Alpha-Helix	; acc "CAA61747" ; collection "CORE" ; comment "-" ; family "High Mobility Group (Box)" ; medline "9161031" ; species "3888" ; tax_group "plants" ; type "SELEX" 
PB0009.1	12.9242390184361	E2F3	Winged Helix-Turn-Helix 	; acc "O35261" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Transcription Factor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0100.1	10.4250580029496	Zic1	Zinc-coordinating 	; acc "P46684" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0441.1	10.4046340371081	ZMS1	Zinc-coordinating	; acc "YJR127C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PH0087.1	13.8597692919252	Irx6	Helix-Turn-Helix 	; acc "Q9ER75" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0018.2	10.1388499313822	CREB1	Zipper-Type	; acc "P16220" ; collection "CORE" ; comment "Annotations from PAZAR CREB1_RAT + CREB1_HUMAN + CREB1_MOUSE in the pleiades genes project (TF0000110, TF0000150, TF0000732)." ; family "Leucine Zipper" ; medline "17916232 " ; pazar_tf_id "TF0000013" ; species "10116,9606,10090" ; tax_group "vertebrates" ; type "COMPILED" 
PH0155.1	14.4868616184394	Prrx2	Helix-Turn-Helix 	; acc "Q06348" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0082.1	19.3265187891226	CTGYNNCTYTAA	Unknown	; MCS "15.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PH0143.1	12.0199683536081	Pou2f1	Helix-Turn-Helix 	; acc "P25425" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0212.1	11.0269730374724	bcd	Helix-Turn-Helix	; acc "P09081" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0182.1	8.66512406989259	CG4328	Helix-Turn-Helix	; acc "Q9VTW3" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0166.1	12.0054460818949	Antp	Helix-Turn-Helix	; acc "P02833" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PF0032.1	16.6021012093703	TGASTMAGC	Unknown	; MCS "27.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "NF-E2" ; type "phylogenetic" 
PB0058.1	13.9933320699988	Six6	Helix-Turn-Helix 	; acc "Q9QZ28" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0417.1	8.48181774612686	YAP5	Zipper-Type	; acc "YIR018W" ; collection "CORE" ; family "Leucine Zipper" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
CN0010.1	17.756621239845	LM10	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "YKGTTTCCATGGAAACMR" ; medline "17442748" ; species "9606" 
MA0295.1	11.6026228315199	FHL1	Winged Helix-Turn-Helix	; acc "YPR104C" ; collection "CORE" ; family "Forkhead" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0043.1	11.1469251071435	HLF	Zipper-Type	; acc "Q16534" ; collection "CORE" ; comment "-" ; family "Leucine Zipper" ; medline "8065331" ; pazar_tf_id "TF0000028" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
MA0310.1	11.6007920124256	HAC1	Zipper-Type	; acc "YFL031W" ; collection "CORE" ; family "Leucine Zipper" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0256.1	11.737647110429	zen	Helix-Turn-Helix	; acc "P09089" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PB0035.1	12.3802307732334	Irf6	Winged Helix-Turn-Helix 	; acc "Q8C2Z7" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Interferon Regulatory Factor " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0136.1	8.69309549377962	ELF5	Winged Helix-Turn-Helix	; acc "" ; collection "CORE" ; comment "-" ; family "Ets" ; medline "16704374" ; pazar_tf_id "TF0000828" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
PB0055.1	13.4719977651124	Rfxdc2	Winged Helix-Turn-Helix 	; acc "Q8CB07" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "RFX  " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0047.1	14.6575447950122	Hoxa11	Helix-Turn-Helix 	; acc "P31311" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0057.1	23.8882588586762	LM57	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGACAGTAATTAGM" ; medline "17442748" ; species "9606" 
PF0101.1	13.0798598934366	CTGCAGY	Unknown	; MCS "13.2" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0034.1	9.31133794025198	Gamyb	Helix-Turn-Helix	; acc "CAA61021" ; collection "CORE" ; comment "-" ; family "Myb" ; medline "10069063" ; species "4513" ; tax_group "plants" ; type "SELEX" 
PH0032.1	15.8069622269752	Evx2	Helix-Turn-Helix 	; acc "P49749" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0158.1	22.7326934596902	LM158	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "AWGGAAAWCWGWTTTCCWW" ; medline "17442748" ; species "9606" 
PB0089.1	16.0719644497273	Zbtb12	Zinc-coordinating	; acc "Q6P6L4" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PL0011.1	15.2193340287478	hlh-2::hlh-4	Zipper-type	; acc "Q17588,P34555" ; collection "PBM_HLH" ; comment "heterodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" 
PB0103.1	14.382464769452	Zscan4	Zinc-coordinating	; acc "XP_145358" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PL0014.1	13.1048253013462	mxl-1::mdl-1	Zipper-type	; acc "P90982,Q21663" ; collection "PBM_HLH" ; comment "heterodimer" ; family "Helix-Loop-Helix" ; medline "19632181" ; species "6239" ; tax_group "nematodes" ; type "PBM" 
CN0120.1	23.0445387614172	LM120	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTTAATTACAGGCW" ; medline "17442748" ; species "9606" 
CN0142.1	25.8247527722756	LM142	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "WNNWNACAGATCATTAACT" ; medline "17442748" ; species "9606" 
MA0009.1	17.8627489557575	T	Beta-Hairpin-Ribbon	; acc "P20293" ; collection "CORE" ; comment "-" ; family "Transcription Factor T" ; medline "8344258" ; pazar_tf_id "TF0000006" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
CN0023.1	18.8800728704782	LM23	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TKACCACCAGGTGGYGCTRW" ; medline "17442748" ; species "9606" 
PB0061.1	11.3816286063338	Sox12	Other Alpha-Helix 	; acc "Q04890" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0296.1	16.2069102545485	FKH1	Winged Helix-Turn-Helix	; acc "YIL131C" ; collection "CORE" ; family "Forkhead" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
PF0169.1	17.751982119229	TTTNNANAGCYR	Unknown	; MCS "9.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PB0099.1	11.1827273376085	Zfp740	Zinc-coordinating	; acc "Q6NZQ6" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PB0027.1	8.36273744730006	Gmeb1	Other Alpha-Helix 	; acc "Q9JL60" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Sand  " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0044.1	8.43180902169531	HMG-1	Other Alpha-Helix	; acc "CAA54168" ; collection "CORE" ; comment "-" ; family "High Mobility Group (Box)" ; medline "9161031" ; species "3888" ; tax_group "plants" ; type "SELEX" 
PF0139.1	15.5659877857067	AAAYWAACM	Unknown	; MCS "11.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "FOXI1" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "HFH-4" ; type "phylogenetic" 
MA0389.1	8.32597507685772	SRD1	Zinc-coordinating	; acc "YCR018C" ; collection "CORE" ; family "GATA" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PB0087.1	11.6130541793796	Tcfap2e	Zipper-Type 	; acc "Q6VUP9" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Helix-Loop-Helix " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0208.1	12.9211641016943	al	Helix-Turn-Helix	; acc "Q06453" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PF0117.1	16.9753244542901	TGTYNNNNNRGCARM	Unknown	; MCS "12.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PB0045.1	11.9458731660375	Mybl1	Helix-Turn-Helix 	; acc "P51960" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Myb  " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0052.1	16.299797260239	YYCATTCAWW	Unknown	; MCS "21.6" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "POU1F1(*)" ; type "phylogenetic" 
MA0224.1	11.3776904659972	exex	Helix-Turn-Helix	; acc "Q9VSC2" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PF0050.1	15.1438737744164	RGAGGAARY	Unknown	; MCS "22.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "PU.1" ; type "phylogenetic" 
PF0051.1	12	TATAAA	Unknown	; MCS "22.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "TBP" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "TATA" ; type "phylogenetic" 
PB0086.1	11.2860722775851	Tcfap2c	Zipper-Type 	; acc "Q61312" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Helix-Loop-Helix " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0297.1	13.4461023665147	FKH2	Winged Helix-Turn-Helix	; acc "YNL068C" ; collection "CORE" ; family "Forkhead" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PH0062.1	11.9040724861442	Hoxb7	Helix-Turn-Helix 	; acc "P09024" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0049.1	13.1419099179088	Hoxa2	Helix-Turn-Helix 	; acc "P31245" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0159.1	16.0043149001931	RXR::RAR_DR5	Zinc-coordinating	; acc "P10276,P19793" ; collection "CORE" ; comment "Dimer. Annotations from PAZAR RXR/RAR_HUMAN (TF0000788) in the RARE project." ; family "Hormone-nuclear Receptor" ; medline "17916232" ; pazar_tf_id "TF0000788" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" 
MA0098.1	7.07782163341167	ETS1	Winged Helix-Turn-Helix	; acc "CAG47050" ; collection "CORE" ; comment "-" ; family "Ets" ; medline "1542566" ; pazar_tf_id "TF0000070" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
PB0097.1	14.9195500318043	Zfp410	Zinc-coordinating	; acc "Q8BKX7" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0158.1	11.8680238554998	Rhox11_2	Helix-Turn-Helix 	; acc "Q810N8" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0097.1	13.0614448983193	YATTNATC	Unknown	; MCS "13.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "CDP(*)" ; type "phylogenetic" 
MA0077.1	9.07881462267178	SOX9	Other Alpha-Helix	; acc "P48436" ; collection "CORE" ; comment "-" ; family "High Mobility Group (Box)" ; medline "9973626" ; pazar_tf_id "TF0000053" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
MA0395.1	11.5163123744163	STP2	Zinc-coordinating	; acc "YHR006W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "18842628" ; species "4932" ; tax_group "fungi" ; type "PBM" 
MA0305.1	10.1503899163061	GCR2	Other	; acc "YNL199C" ; collection "CORE" ; family "Other" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
MA0154.1	11.564474858736	EBF1	Zipper-Type	; acc "Q07802" ; collection "CORE" ; comment "Annotations from PAZAR EBF1_MOUSE (TF0000762) in the Olf_Ebf_TFBS project." ; family "Helix-Loop-Helix" ; medline "17916232" ; pazar_tf_id "TF0000762" ; species "10090" ; tax_group "vertebrates" ; type "COMPILED" 
MA0267.1	9.51912756205394	ACE2	Zinc-coordinating	; acc "YLR131C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
CN0202.1	22.9993911672978	LM202	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTTGCCAAATGTGAATT" ; medline "17442748" ; species "9606" 
MA0205.1	7.69842587143543	Trl	Zinc-coordinating	; acc "Q08605" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "15572468" ; species "7227" ; tax_group "insects" ; type "DNaseI footprinting" 
MA0416.1	12.3879218074446	YAP3	Zipper-Type	; acc "YHL009C" ; collection "CORE" ; family "Leucine Zipper" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PF0072.1	14.01182656851	TTCYRGAA	Unknown	; MCS "17.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0151.1	9.89631870738828	ARID3A	Helix-Turn-Helix	; acc "Q62431" ; collection "CORE" ; comment "Annotations from PAZAR ARID3A_MOUSE in the TFe project (TF0000816)." ; family "Arid" ; medline "8543152" ; pazar_tf_id "TF0000816" ; species "10090" ; tax_group "vertebrates" ; type "SELEX" 
CN0196.1	24.4372926458252	LM196	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "ATTCATTTTGGCTTTGAAAG" ; medline "17442748" ; species "9606" 
PH0056.1	12.4299319336993	Hoxa9	Helix-Turn-Helix 	; acc "P09631" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0266.1	10.6646221241324	ABF2	Other Alpha-Helix	; acc "YMR072W" ; collection "CORE" ; family "High Mobility Group (Box)" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0339.1	9.02862103383954	MIG3	Zinc-coordinating	; acc "YER028C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0333.1	11.350318795624	MET31	Zinc-coordinating	; acc "YPL038W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0430.1	10.5825139729207	YLR278C	Zinc-coordinating	; acc "YLR278C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PH0125.1	15.1138171720684	Obox5_2	Helix-Turn-Helix 	; acc "Q7TPZ5" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0049.1	14.0223316971708	CATTGTYY	Unknown	; MCS "22.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "SOX9" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "SOX-9" ; type "phylogenetic" 
PF0099.1	17.6159262597918	ATCMNTCCGY	Unknown	; MCS "13.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0293.1	7.49642240276808	ECM23	Zinc-coordinating	; acc "YPL021W" ; collection "CORE" ; family "GATA" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0186.1	11.1809068160911	Dfd	Helix-Turn-Helix	; acc "P07548" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PF0061.1	15.0482766179379	YTAATTAA	Unknown	; MCS "19.8" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "LHX3" ; type "phylogenetic" 
MA0437.1	9.628511594936	YPR196W	Zinc-coordinating	; acc "YPR196W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0072.1	17.4248426117905	RORA_2	Zinc-coordinating	; acc "NP_599022" ; collection "CORE" ; comment "isoform type" ; family "Hormone-nuclear Receptor" ; medline "7926749" ; pazar_tf_id "TF0000048" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
MA0394.1	10.5526879446483	STP1	Zinc-coordinating	; acc "YDR463W" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "16522208" ; species "4932" ; tax_group "fungi" ; type "ChIP-on-chip" 
PH0058.1	11.9639844795863	Hoxb3	Helix-Turn-Helix 	; acc "P09026" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0194.1	13.187198236074	Lim1	Helix-Turn-Helix	; acc "Q9V472" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0206.1	10.5213421405292	abd-A	Helix-Turn-Helix	; acc "P29555" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PH0173.1	14.6098702107201	Uncx	Helix-Turn-Helix 	; acc "Q78DU3" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0036.1	12.3422728561702	Gsx2	Helix-Turn-Helix 	; acc "P31316" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0009.1	14.4006449074309	TGAYRTCA	Unknown	; MCS "55.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "ATF3" ; type "phylogenetic" 
CN0151.1	29.1731745650393	LM151	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "MCCTGAAGCATGARATTTGATTR" ; medline "17442748" ; species "9606" 
MA0215.1	10.1647648815424	btn	Helix-Turn-Helix	; acc "Q9U984" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PF0118.1	17.9681171046028	GGCNRNWCTTYS	Unknown	; MCS "12.0" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PH0165.1	15.1559199114665	Six6_1	Helix-Turn-Helix 	; acc "Q9QZ28" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0036.1	24.3913279602104	LM36	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "KGAAAWKNNAWTTYCHW" ; medline "17442748" ; species "9606" 
PB0063.1	10.8378886546464	Sox14	Other Alpha-Helix 	; acc "Q04892" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "High Mobility Group (Box) " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0179.1	10.7811831829612	CG32532	Helix-Turn-Helix	; acc "Q9VWH1" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PB0101.1	10.2455979309305	Zic2	Zinc-coordinating 	; acc "Q62520" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0225.1	11.123180337017	ftz	Helix-Turn-Helix	; acc "P02835" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
CN0059.1	20.9838891823972	LM59	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGWCATTTTGACAG" ; medline "17442748" ; species "9606" 
CN0228.1	24.1029766656565	LM228	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGTTTCATAAAGCTG" ; medline "17442748" ; species "9606" 
MA0037.1	6.62989113890047	GATA3	Zinc-coordinating	; acc "P23771" ; collection "CORE" ; comment "-" ; family "GATA" ; medline "8321207" ; pazar_tf_id "TF0000024" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
CN0173.1	23.827639429503	LM173	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "ACTGATTTTCCTGACAA" ; medline "17442748" ; species "9606" 
MA0177.1	10.8076509061582	CG18599	Helix-Turn-Helix	; acc "Q9VEA3" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PF0045.1	18.9552307732213	CCANNAGRKGGC	Unknown	; MCS "23.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PH0073.1	11.8880919233097	Hoxc9	Helix-Turn-Helix 	; acc "P09633" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0068.1	14.0685007703835	Hoxc13	Helix-Turn-Helix 	; acc "P50207" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PF0110.1	16.3343490971089	MCAATNNNNNGCG	Unknown	; MCS "12.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PB0093.1	13.6226474234745	Zfp128	Zinc-coordinating	; acc "Q52KP6" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger" ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0039.1	13.109562167477	Mnx1	Helix-Turn-Helix 	; acc "Q9QZW9" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0106.1	11.9516086179875	Msx1	Helix-Turn-Helix 	; acc "P13297" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0031.1	23.4301510765849	LM31	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CTTTTCATCTTCAAAGYRCTTT" ; medline "17442748" ; species "9606" 
MA0116.1	17.9252482810031	Zfp423	Zinc-coordinating	; acc "O08961" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "9774661" ; pazar_tf_id "TF0000081" ; species "10116" ; tax_group "vertebrates" ; type "SELEX" 
PB0085.1	12.0421025600468	Tcfap2b	Zipper-Type 	; acc "Q61313" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Helix-Loop-Helix " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0126.1	9.60193933972294	ovo	Zinc-coordinating	; acc "P51521" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "10637336" ; pazar_tf_id "TF0000821" ; species "7227" ; tax_group "insects" ; type "SELEX" 
MA0438.1	10.64261968031	YRM1	Zinc-coordinating	; acc "YOR172W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PF0027.1	14.42554536176	TGGNNNNNNKCCAR	Unknown	; MCS "32.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PF0171.1	15.9617462877539	CTCNANGTGNY	Unknown	; MCS "9.1" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0282.1	11.6351550443192	CEP3	Zinc-coordinating	; acc "YMR168C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0211.1	12.5974217698483	bap	Helix-Turn-Helix	; acc "P22809" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0241.1	11.1827921370707	ro	Helix-Turn-Helix	; acc "P10181" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0360.1	11.9571542697438	RDR1	Zinc-coordinating	; acc "YOR380W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
CN0211.1	24.8132048190737	LM211	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TGACCTAGAGGTGAAAGGC" ; medline "17442748" ; species "9606" 
CN0091.1	24.1856242757097	LM91	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "CARCTGTGWAATTG" ; medline "17442748" ; species "9606" 
MF0006.1	7.89193388107753	bZIP cEBP-like subclass	bZIP	; acc "" ; collection "FAM" ; comment "-" ; included_models "MA0019,MA0025,MA0043,MA0102" ; medline "15066426" ; species "" ; type "METAMODEL" 
POL011.1	16.7194781404227	XCPE1	Unknown	; Description "The matrix is made of the human promoter sequences that are shown in the supplementary material (Table S1). We included only the sites that show XCPE1 activity in vitro." ; End relative to TSS "+2" ; Start relative to TSS "-8" ; acc "" ; collection "POLII" ; comment "-" ; medline "17210644" ; species "" 
MA0058.1	12.6854143466175	MAX	Zipper-Type	; acc "AAH36092" ; collection "CORE" ; comment "-" ; family "Helix-Loop-Helix" ; medline "8265351" ; pazar_tf_id "TF0000037" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
CN0160.1	23.9941793382506	LM160	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "RCTTTCAGAAATSMMWWWW" ; medline "17442748" ; species "9606" 
MA0356.1	7.44150819522477	PHO2	Helix-Turn-Helix	; acc "YDL106C" ; collection "CORE" ; family "Homeo" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PH0076.1	14.9329524291558	Hoxd11	Helix-Turn-Helix 	; acc "P23813" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0044.1	20.6570285246285	LM44	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GTGTAATTGGAAACAGCTG" ; medline "17442748" ; species "9606" 
MA0074.1	20.4511671987138	RXRA::VDR	Zinc-coordinating	; acc "P19793,P11473" ; collection "CORE" ; comment "heterodimer between RXRA and VDR" ; family "Hormone-nuclear Receptor" ; medline "8674817" ; pazar_tf_id "TF0000050" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
PF0122.1	16.8199206715049	RNTCANNRNNYNATTW	Unknown	; MCS "11.7" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
CN0212.1	23.8848573552489	LM212	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "ATGGCTTTCCAAATG" ; medline "17442748" ; species "9606" 
PH0019.1	10.2386445052527	Dbx2	Helix-Turn-Helix 	; acc "Q8BZD0" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0185.1	8.27226975609829	Deaf1	Other Alpha-Helix	; acc "Q24180" ; collection "CORE" ; comment "-" ; family "Sand" ; medline "15572468" ; species "7227" ; tax_group "insects" ; type "DNaseI footprinting" 
PH0016.1	9.98907329398038	Cux1_1	Helix-Turn-Helix 	; acc "P70403" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0423.1	11.403478658641	YER130C	Zinc-coordinating	; acc "YER130C" ; collection "CORE" ; family "BetaBetaAlpha-zinc finger" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PH0151.1	14.6626797730926	Pou6f1_1	Helix-Turn-Helix 	; acc "Q07916" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0143.1	12.9512704531914	Sox2	Other Alpha-Helix	; acc "P48432" ; collection "CORE" ; comment "-" ; family "High Mobility Group (Box)" ; medline "18555785" ; pazar_tf_id "TF0000779" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" 
MA0101.1	10.514792387777	REL	Ig-fold	; acc "Q04864" ; collection "CORE" ; comment "-" ; family "Rel Homology Region" ; medline "1406630" ; pazar_tf_id "TF0000073" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
PF0150.1	17.9010562177425	YTTCCNNNGGAMR	Unknown	; MCS "10.4" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PH0114.1	14.6798948278887	Nkx2-5	Helix-Turn-Helix 	; acc "P42582" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
PH0046.1	11.6647251436197	Hoxa10	Helix-Turn-Helix 	; acc "P31310" ; collection "PBM_HOMEO" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "18585359" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
CN0130.1	22.3891802519928	LM130	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TCTGATTGGCTGKCR" ; medline "17442748" ; species "9606" 
MA0411.1	8.68377695225234	UPC2	Zinc-coordinating	; acc "YDR213W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PB0006.1	11.7961228762501	Bcl6b	Zinc-coordinating 	; acc "O88282" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "BetaBetaAlpha-zinc finger " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0039.2	12.6183576805199	Klf4	Zinc-coordinating	; acc "Q60793" ; collection "CORE" ; comment "- " ; family "BetaBetaAlpha-zinc finger" ; medline "18555785 " ; pazar_tf_id "TF0000026" ; species "10090" ; tax_group "vertebrates" ; type "ChiP-seq" 
CN0004.1	22.9781135839097	LM4	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "RGCMTKCTGGGARTTGTAGTYY" ; medline "17442748" ; species "9606" 
MA0311.1	9.046501418024	HAL9	Zinc-coordinating	; acc "YOL089C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0112.2	13.5630609490181	ESR1	Zinc-coordinating	; acc "P03372" ; collection "CORE" ; comment "-" ; family "Hormone-nuclear Receptor" ; medline "19339991" ; pazar_tf_id "TF0000189" ; species "9606" ; tax_group "vertebrates" ; type "ChiP-seq" 
MA0414.1	8.93156487911214	XBP1	Ig-fold	; acc "YIL101C" ; collection "CORE" ; family "Rel Homology Region" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
CN0159.1	23.2126876530612	LM159	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "TTGCTTTGGAAGCAGCT" ; medline "17442748" ; species "9606" 
MA0317.1	8.82955428161502	HCM1	Winged Helix-Turn-Helix	; acc "YCR065W" ; collection "CORE" ; family "Forkhead" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PF0005.1	13.1207076355866	GATTGGY	Unknown	; MCS "64.6" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "NF-Y" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "NF-Y" ; type "phylogenetic" 
MA0031.1	11.9264176788219	FOXD1	Winged Helix-Turn-Helix	; acc "Q16676" ; collection "CORE" ; comment "-" ; family "Forkhead" ; medline "7957066" ; species "9606" ; tax_group "vertebrates" ; type "SELEX" 
PF0124.1	15.8840652682399	CCAWYNNGAAR	Unknown	; MCS "11.5" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0284.1	11.4485886306829	CIN5	Zipper-Type	; acc "YOR028C" ; collection "CORE" ; family "Leucine Zipper" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
PF0128.1	16.7895256979172	RYCACNNRNNRNCAG	Unknown	; MCS "11.3" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
PF0160.1	16.9115857648467	CAGNYGKNAAA	Unknown	; MCS "9.9" ; acc "" ; collection "PHYLOFACTS" ; comment "-" ; jaspar "-" ; medline "15735639" ; species "" ; tax_group "mammals" ; transfac "-" ; type "phylogenetic" 
MA0428.1	10.5333189874106	YKL222C	Zinc-coordinating	; acc "YKL222C" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip" 
MA0229.1	12.4366688007437	inv	Helix-Turn-Helix	; acc "P05527" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18585360" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
MA0017.1	15.9238684526357	NR2F1	Zinc-coordinating	; acc "P10589" ; collection "CORE" ; comment "-" ; family "Hormone-nuclear Receptor" ; medline "8496174" ; pazar_tf_id "TF0000012" ; species "9606" ; tax_group "vertebrates" ; type "COMPILED" 
MA0103.1	8.30486487593768	ZEB1	Zinc-coordinating	; acc "P36197" ; collection "CORE" ; comment "-" ; family "BetaBetaAlpha-zinc finger" ; medline "8065305" ; pazar_tf_id "TF0000074" ; species "9031" ; tax_group "vertebrates" ; type "SELEX" 
CN0227.1	25.4288209025039	LM227	unknown	; acc "" ; collection "CNE" ; comment "-" ; consensus "GAATTTAGTGCTTGTGAAAA" ; medline "17442748" ; species "9606" 
MA0192.1	11.4976509235011	Hmx	Helix-Turn-Helix	; acc "Q9VEI9" ; collection "CORE" ; comment "-" ; family "Homeo" ; medline "18332042" ; species "7227" ; tax_group "insects" ; type "bacterial 1-hybrid" 
PB0047.1	13.158095857342	Nkx3-1	Helix-Turn-Helix 	; acc "P97436" ; collection "PBM" ; comment "Data is from Uniprobe database" ; family "Homeo " ; medline "19443739" ; pazar_tf_id "" ; species "10090" ; tax_group "vertebrates" ; type "universal protein binding microarray (PBM)" 
MA0324.1	12.2676275792558	LEU3	Zinc-coordinating	; acc "YLR451W" ; collection "CORE" ; family "Fungal Zn cluster" ; medline "19111667" ; species "4932" ; tax_group "fungi" ; type "PBM, CSA and/or DIP-chip"