9229	class	Other Alpha-Helix
9229	comment	-
9229	family	MADS
9229	medline	7632923
9229	tax_group	plants
9229	type	SELEX
9230	class	Ig-fold
9230	comment	Matrix changed since last release: removal of primers and sites overlapping primers
9230	family	Runt
9230	medline	8413232
9230	pazar_tf_id	TF0000001
9230	tax_group	vertebrates
9230	type	SELEX
9231	class	Zipper-Type
9231	comment	-
9231	family	Helix-Loop-Helix
9231	medline	10497269
9231	pazar_tf_id	TF0000002
9231	tax_group	vertebrates
9231	type	SELEX
9232	class	Zipper-Type
9232	comment	-
9232	family	Helix-Loop-Helix
9232	medline	7592839
9232	pazar_tf_id	TF0000003
9232	tax_group	vertebrates
9232	type	SELEX
9233	class	Other Alpha-Helix
9233	comment	dimer
9233	family	MADS
9233	medline	7901838
9233	tax_group	plants
9233	type	SELEX
9234	class	Zipper-Type
9234	comment	dimer
9234	family	Helix-Loop-Helix
9234	medline	7592839
9234	pazar_tf_id	TF0000004
9234	tax_group	vertebrates
9234	type	SELEX
9235	class	Zinc-coordinating
9235	comment	-
9235	family	Hormone-nuclear Receptor
9235	medline	1491700
9235	pazar_tf_id	TF0000005
9235	tax_group	vertebrates
9235	type	SELEX
9236	class	Helix-Turn-Helix
9236	comment	homodimer
9236	family	Homeo
9236	medline	8253077
9236	tax_group	plants
9236	type	SELEX
9237	class	Beta-Hairpin-Ribbon
9237	comment	-
9237	family	T
9237	medline	8344258
9237	pazar_tf_id	TF0000006
9237	tax_group	vertebrates
9237	type	SELEX
9238	class	Zinc-coordinating
9238	comment	Different splice forms affect DNA binding: four matrices
9238	family	BetaBetaAlpha-zinc finger
9238	medline	8062827
9238	pazar_tf_id	TF0000007
9238	tax_group	insects
9238	type	COMPILED
9239	class	Zinc-coordinating
9239	comment	Different splice forms affect DNA binding: four matrices
9239	family	BetaBetaAlpha-zinc finger
9239	medline	8062827
9239	pazar_tf_id	TF0000008
9239	tax_group	insects
9239	type	COMPILED
9240	class	Zinc-coordinating
9240	comment	Different splice forms affect DNA binding: four matrices
9240	family	BetaBetaAlpha-zinc finger
9240	medline	8062827
9240	pazar_tf_id	TF0000009
9240	tax_group	insects
9240	type	COMPILED
9241	class	Zinc-coordinating
9241	comment	Different splice forms affect DNA binding: four matrices
9241	family	BetaBetaAlpha-zinc finger
9241	medline	8062827
9241	pazar_tf_id	TF0000010
9241	tax_group	insects
9241	type	COMPILED
9242	class	Helix-Turn-Helix
9242	comment	-
9242	family	Homeo
9242	medline	8406007
9242	pazar_tf_id	TF0000011
9242	tax_group	vertebrates
9242	type	COMPILED
9243	class	Zinc-coordinating
9243	comment	-
9243	family	BetaBetaAlpha-zinc finger
9243	medline	1290524
9243	tax_group	insects
9243	type	SELEX
9244	class	Zinc-coordinating
9244	comment	-
9244	family	Hormone-nuclear Receptor
9244	medline	1280827
9244	tax_group	insects
9244	type	SELEX
9245	class	Zinc-coordinating
9245	comment	-
9245	family	Hormone-nuclear Receptor
9245	medline	8496174
9245	pazar_tf_id	TF0000012
9245	tax_group	vertebrates
9245	type	COMPILED
9246	class	Zipper-Type
9246	comment	-
9246	family	Leucine Zipper
9246	medline	8264613
9246	pazar_tf_id	TF0000013
9246	tax_group	vertebrates
9246	type	SELEX
9247	class	Zipper-Type
9247	comment	dimer between Ddit3 and Cebpa
9247	family	Leucine Zipper
9247	medline	8657121
9247	tax_group	vertebrates
9247	type	SELEX
9248	class	Zinc-coordinating
9248	comment	-
9248	family	Dof
9248	medline	10074718
9248	tax_group	plants
9248	type	SELEX
9249	class	Zinc-coordinating
9249	comment	-
9249	family	Dof
9249	medline	10074718
9249	tax_group	plants
9249	type	SELEX
9250	class	Ig-fold
9250	comment	dl has a dual binding specificity and therefore two models: MA0022 and MA0023
9250	family	Rel
9250	medline	1582412
9250	tax_group	insects
9250	type	SELEX
9251	class	Ig-fold
9251	comment	dl has a dual binding specificity and therefore two models: MA0022 and MA0023
9251	family	Rel
9251	medline	1582412
9251	tax_group	insects
9251	type	SELEX
9252	class	Winged Helix-Turn-Helix
9252	comment	-
9252	family	E2F
9252	medline	1411535
9252	pazar_tf_id	TF0000014
9252	tax_group	vertebrates
9252	type	COMPILED
9253	class	Zipper-Type
9253	comment	-
9253	family	Leucine Zipper
9253	medline	1620116
9253	pazar_tf_id	TF0000015
9253	tax_group	vertebrates
9253	type	SELEX
9254	class	Winged Helix-Turn-Helix
9254	comment	-
9254	family	Ets
9254	medline	2208281
9254	tax_group	insects
9254	type	SELEX
9255	class	Helix-Turn-Helix
9255	comment	-
9255	family	Homeo
9255	medline	8096059
9255	pazar_tf_id	TF0000016
9255	tax_group	vertebrates
9255	type	SELEX
9256	class	Winged Helix-Turn-Helix
9256	comment	-
9256	family	Ets
9256	medline	1425594
9256	pazar_tf_id	TF0000017
9256	tax_group	vertebrates
9256	type	SELEX
9257	class	Zinc-coordinating
9257	comment	-
9257	family	BetaBetaAlpha-zinc finger
9257	medline	8321231
9257	pazar_tf_id	TF0000018
9257	tax_group	vertebrates
9257	type	SELEX
9258	class	Winged Helix-Turn-Helix
9258	comment	-
9258	family	Forkhead
9258	medline	7957066
9258	pazar_tf_id	TF0000019
9258	tax_group	vertebrates
9258	type	SELEX
9259	class	Winged Helix-Turn-Helix
9259	comment	-
9259	family	Forkhead
9259	medline	7957066
9259	tax_group	vertebrates
9259	type	SELEX
9260	class	Winged Helix-Turn-Helix
9260	comment	-
9260	family	Forkhead
9260	medline	7957066
9260	pazar_tf_id	TF0000020
9260	tax_group	vertebrates
9260	type	SELEX
9261	class	Winged Helix-Turn-Helix
9261	comment	-
9261	family	Forkhead
9261	medline	7957066
9261	pazar_tf_id	TF0000021
9261	tax_group	vertebrates
9261	type	SELEX
9262	class	Helix-Turn-Helix
9262	comment	-
9262	family	Myb
9262	medline	10069063
9262	tax_group	plants
9262	type	SELEX
9263	class	Zinc-coordinating
9263	comment	-
9263	family	GATA
9263	medline	8321207
9263	pazar_tf_id	TF0000022
9263	tax_group	vertebrates
9263	type	SELEX
9264	class	Zinc-coordinating
9264	comment	-
9264	family	GATA
9264	medline	8321207
9264	pazar_tf_id	TF0000023
9264	tax_group	vertebrates
9264	type	SELEX
9265	class	Zinc-coordinating
9265	comment	-
9265	family	GATA
9265	medline	8321207
9265	pazar_tf_id	TF0000024
9265	tax_group	vertebrates
9265	type	SELEX
9266	class	Zinc-coordinating
9266	comment	-
9266	family	BetaBetaAlpha-zinc finger
9266	medline	8754800
9266	pazar_tf_id	TF0000025
9266	tax_group	vertebrates
9266	type	SELEX
9267	class	Zinc-coordinating
9267	comment	-
9267	family	BetaBetaAlpha-zinc finger
9267	medline	9443972
9267	pazar_tf_id	TF0000026
9267	tax_group	vertebrates
9267	type	SELEX
9268	class	Winged Helix-Turn-Helix
9268	comment	-
9268	family	Forkhead
9268	medline	8139574
9268	tax_group	vertebrates
9268	type	SELEX
9269	class	Winged Helix-Turn-Helix
9269	comment	-
9269	family	Forkhead
9269	medline	8139574
9269	tax_group	vertebrates
9269	type	SELEX
9270	class	Winged Helix-Turn-Helix
9270	comment	-
9270	family	Forkhead
9270	medline	9153225
9270	pazar_tf_id	TF0000027
9270	tax_group	vertebrates
9270	type	SELEX
9271	class	Zipper-Type
9271	comment	-
9271	family	Leucine Zipper
9271	medline	8065331
9271	pazar_tf_id	TF0000028
9271	tax_group	vertebrates
9271	type	SELEX
9272	class	Other Alpha-Helix
9272	comment	-
9272	family	High Mobility Group box (HMG)
9272	medline	9161031
9272	tax_group	plants
9272	type	SELEX
9273	class	Other Alpha-Helix
9273	comment	-
9273	family	High Mobility Group box (HMG)
9273	medline	9161031
9273	tax_group	plants
9273	type	SELEX
9274	class	Helix-Turn-Helix
9274	comment	-
9274	family	Homeo
9274	medline	9047360
9274	tax_group	vertebrates
9274	type	COMPILED
9275	class	Winged Helix-Turn-Helix
9275	comment	-
9275	family	Forkhead
9275	medline	8139574
9275	pazar_tf_id	TF0000029
9275	tax_group	vertebrates
9275	type	COMPILED
9276	class	Zipper-Type
9276	comment	-
9276	family	Helix-Loop-Helix
9276	medline	8289804
9276	pazar_tf_id	TF0000030
9276	tax_group	vertebrates
9276	type	SELEX
9277	class	Zinc-coordinating
9277	comment	-
9277	family	BetaBetaAlpha-zinc finger
9277	medline	2507923
9277	pazar_tf_id	TF0000031
9277	tax_group	insects
9277	type	COMPILED
9278	class	Winged Helix-Turn-Helix
9278	comment	-
9278	family	IRF
9278	medline	7687740
9278	pazar_tf_id	TF0000032
9278	tax_group	vertebrates
9278	type	SELEX
9279	class	Winged Helix-Turn-Helix
9279	comment	-
9279	family	IRF
9279	medline	7687740
9279	pazar_tf_id	TF0000033
9279	tax_group	vertebrates
9279	type	SELEX
9280	class	Other Alpha-Helix
9280	comment	-
9280	family	MADS
9280	medline	1748287
9280	pazar_tf_id	TF0000034
9280	tax_group	vertebrates
9280	type	SELEX
9281	class	Zinc-coordinating
9281	comment	-
9281	family	Dof
9281	medline	10074718
9281	tax_group	plants
9281	type	SELEX
9282	class	Helix-Turn-Helix
9282	comment	-
9282	family	Myb
9282	medline	7737128
9282	tax_group	plants
9282	type	SELEX
10621	description	-
10622	description	nuclear transcription factor Y,beta
9377	description	-
9284	class	Zinc-coordinating
9284	comment	-
9284	family	BetaBetaAlpha-zinc finger
9284	medline	8114711
9284	pazar_tf_id	TF0000035
9284	tax_group	vertebrates
9284	type	SELEX
9285	class	Zinc-coordinating
9285	comment	-
9285	family	BetaBetaAlpha-zinc finger
9285	medline	8114711
9285	pazar_tf_id	TF0000036
9285	tax_group	vertebrates
9285	type	SELEX
9286	class	Zipper-Type
9286	comment	-
9286	family	Helix-Loop-Helix
9286	medline	8265351
9286	pazar_tf_id	TF0000037
9286	tax_group	vertebrates
9286	type	SELEX
9287	class	Zipper-Type
9287	comment	Heterodimer of MYC and MAX
9287	family	Helix-Loop-Helix
9287	medline	8265351
9287	pazar_tf_id	TF0000038
9287	tax_group	vertebrates
9287	type	SELEX
9288	class	Other Alpha-Helix
9288	comment	-
9288	family	NFY CCAAT-binding
9288	medline	9469818
9288	tax_group	vertebrates
9288	type	COMPILED
9289	class	Ig-fold
9289	comment	-
9289	family	Rel
9289	medline	8449662
9289	tax_group	vertebrates
9289	type	COMPILED
9290	class	Winged Helix-Turn-Helix
9290	comment	-
9290	family	Ets
9290	medline	8383622
9290	pazar_tf_id	TF0000039
9290	tax_group	vertebrates
9290	type	COMPILED
9291	class	Helix-Turn-Helix
9291	comment	-
9291	family	Homeo
9291	medline	7797561
9291	pazar_tf_id	TF0000040
9291	tax_group	vertebrates
9291	type	SELEX
9292	class	Zinc-coordinating
9292	comment	-
9292	family	Dof
9292	medline	10074718
9292	tax_group	plants
9292	type	SELEX
9293	class	Zinc-coordinating
9293	comment	Heterodimer between PPARG and RXRA
9293	family	Hormone-nuclear Receptor
9293	medline	11139380
9293	pazar_tf_id	TF0000041
9293	tax_group	vertebrates
9293	type	SELEX
9294	class	Zinc-coordinating
9294	comment	-
9294	family	Hormone-nuclear Receptor
9294	medline	11139380
9294	pazar_tf_id	TF0000042
9294	tax_group	vertebrates
9294	type	SELEX
9295	class	Helix-Turn-Helix
9295	comment	-
9295	family	Homeo
9295	medline	8132558
9295	pazar_tf_id	TF0000043
9295	tax_group	vertebrates
9295	type	SELEX
9296	class	Helix-Turn-Helix
9296	comment	-
9296	family	Homeo
9296	medline	10567552
9296	pazar_tf_id	TF0000044
9296	tax_group	vertebrates
9296	type	SELEX
9297	class	Helix-Turn-Helix
9297	comment	-
9297	family	Homeo
9297	medline	8132558
9297	pazar_tf_id	TF0000045
9297	tax_group	vertebrates
9297	type	SELEX
9298	class	Helix-Turn-Helix
9298	comment	-
9298	family	Homeo
9298	medline	7910944
9298	pazar_tf_id	TF0000046
9298	tax_group	vertebrates
9298	type	SELEX
9299	class	Zinc-coordinating
9299	comment	isoform type
9299	family	Hormone-nuclear Receptor
9299	medline	7926749
9299	pazar_tf_id	TF0000047
9299	tax_group	vertebrates
9299	type	SELEX
9300	class	Zinc-coordinating
9300	comment	isoform type
9300	family	Hormone-nuclear Receptor
9300	medline	7926749
9300	pazar_tf_id	TF0000048
9300	tax_group	vertebrates
9300	type	SELEX
9301	class	Zinc-coordinating
9301	comment	-
9301	family	BetaBetaAlpha-zinc finger
9301	medline	8816445
9301	pazar_tf_id	TF0000049
9301	tax_group	vertebrates
9301	type	SELEX
9302	class	Zinc-coordinating
9302	comment	heterodimer between RXRA and VDR
9302	family	Hormone-nuclear Receptor
9302	medline	8674817
9302	pazar_tf_id	TF0000050
9302	tax_group	vertebrates
9302	type	SELEX
9303	class	Helix-Turn-Helix
9303	comment	-
9303	family	Homeo
9303	medline	7901837
9303	pazar_tf_id	TF0000051
9303	tax_group	vertebrates
9303	type	SELEX
9304	class	Winged Helix-Turn-Helix
9304	comment	-
9304	family	Ets
9304	medline	8524663
9304	pazar_tf_id	TF0000052
9304	tax_group	vertebrates
9304	type	SELEX
9305	class	Other Alpha-Helix
9305	comment	-
9305	family	High Mobility Group box (HMG)
9305	medline	9973626
9305	pazar_tf_id	TF0000053
9305	tax_group	vertebrates
9305	type	SELEX
9306	class	Other Alpha-Helix
9306	comment	-
9306	family	High Mobility Group box (HMG)
9306	medline	8636240
9306	pazar_tf_id	TF0000054
9306	tax_group	vertebrates
9306	type	SELEX
9307	class	Zinc-coordinating
9307	comment	-
9307	family	BetaBetaAlpha-zinc finger
9307	medline	2192357
9307	pazar_tf_id	TF0000055
9307	tax_group	vertebrates
9307	type	SELEX
9308	class	Winged Helix-Turn-Helix
9308	comment	-
9308	family	Ets
9308	medline	7624145
9308	pazar_tf_id	TF0000056
9308	tax_group	vertebrates
9308	type	SELEX
9309	class	Winged Helix-Turn-Helix
9309	comment	-
9309	family	Ets
9309	medline	7624145
9309	pazar_tf_id	TF0000057
9309	tax_group	vertebrates
9309	type	SELEX
9310	class	Other Alpha-Helix
9310	comment	-
9310	family	MADS
9310	medline	9826749
9310	tax_group	plants
9310	type	SELEX
9311	class	Other Alpha-Helix
9311	comment	-
9311	family	MADS
9311	medline	2243767
9311	pazar_tf_id	TF0000058
9311	tax_group	vertebrates
9311	type	SELEX
9312	class	Other Alpha-Helix
9312	comment	-
9312	family	High Mobility Group box (HMG)
9312	medline	8190643
9312	pazar_tf_id	TF0000059
9312	tax_group	vertebrates
9312	type	SELEX
9313	class	Other
9313	comment	-
9313	family	LAG1
9313	medline	7590239
9313	pazar_tf_id	TF0000060
9313	tax_group	insects
9313	type	COMPILED
9314	class	Zinc-coordinating
9314	comment	-
9314	family	BetaBetaAlpha-zinc finger
9314	medline	8371971
9314	pazar_tf_id	TF0000061
9314	tax_group	insects
9314	type	SELEX
9315	class	Other Alpha-Helix
9315	comment	-
9315	family	High Mobility Group box (HMG)
9315	medline	1396566
9315	pazar_tf_id	TF0000062
9315	tax_group	vertebrates
9315	type	SELEX
9316	class	Zinc-coordinating
9316	comment	-
9316	family	BetaBetaAlpha-zinc finger
9316	medline	9009278
9316	tax_group	vertebrates
9316	type	COMPILED
9317	class	Zipper-Type
9317	comment	Heterodimer between TCF11 and Mafg
9317	family	Leucine Zipper
9317	medline	9421508
9317	pazar_tf_id	TF0000063
9317	tax_group	vertebrates
9317	type	SELEX
9318	class	Helix-Turn-Helix
9318	comment	-
9318	family	Homeo
9318	medline	9571041
9318	pazar_tf_id	TF0000064
9318	tax_group	vertebrates
9318	type	COMPILED
9319	class	Zipper-Type
9319	comment	Heterodimer between TAL1 and TCF3
9319	family	Helix-Loop-Helix
9319	medline	8289805
9319	pazar_tf_id	TF0000065
9319	tax_group	vertebrates
9319	type	SELEX
9320	class	Zipper-Type
9320	comment	-
9320	family	Helix-Loop-Helix
9320	medline	7791788
9320	pazar_tf_id	TF0000066
9320	tax_group	vertebrates
9320	type	SELEX
9321	class	Zipper-Type
9321	comment	-
9321	family	Helix-Loop-Helix
9321	medline	8052536
9321	pazar_tf_id	TF0000067
9321	tax_group	vertebrates
9321	type	SELEX
9322	class	Helix-Turn-Helix
9322	comment	-
9322	family	Homeo
9322	medline	1673656
9322	pazar_tf_id	TF0000068
9322	tax_group	insects
9322	type	SELEX
9323	class	Zinc-coordinating
9323	comment	-
9323	family	BetaBetaAlpha-zinc finger
9323	medline	7816599
9323	pazar_tf_id	TF0000069
9323	tax_group	vertebrates
9323	type	COMPILED
9324	class	Zipper-Type
9324	comment	-
9324	family	Leucine Zipper
9324	medline	9680995
9324	tax_group	plants
9324	type	SELEX
9325	class	Zipper-Type
9325	comment	-
9325	family	Leucine Zipper
9325	medline	9680995
9325	tax_group	plants
9325	type	SELEX
9326	class	Winged Helix-Turn-Helix
9326	comment	-
9326	family	Ets
9326	medline	1542566
9326	pazar_tf_id	TF0000070
9326	tax_group	vertebrates
9326	type	SELEX
9327	class	Zipper-Type
9327	comment	-
9327	family	Leucine Zipper
9327	medline	2243767
9327	pazar_tf_id	TF0000071
9327	tax_group	vertebrates
9327	type	SELEX
9328	class	Helix-Turn-Helix
9328	comment	-
9328	family	Myb
9328	medline	1861984
9328	pazar_tf_id	TF0000072
9328	tax_group	vertebrates
9328	type	SELEX
9329	class	Ig-fold
9329	comment	-
9329	family	Rel
9329	medline	1406630
9329	pazar_tf_id	TF0000073
9329	tax_group	vertebrates
9329	type	SELEX
9330	class	Zipper-Type
9330	comment	-
9330	family	Leucine Zipper
9330	medline	1672737
9330	tax_group	vertebrates
9330	type	COMPILED
9331	class	Zinc-coordinating
9331	comment	-
9331	family	BetaBetaAlpha-zinc finger
9331	medline	8065305
9331	pazar_tf_id	TF0000074
9331	tax_group	vertebrates
9331	type	SELEX
9332	class	Zipper-Type
9332	comment	-
9332	family	Helix-Loop-Helix
9332	medline	1594445
9332	pazar_tf_id	TF0000075
9332	tax_group	vertebrates
9332	type	SELEX
9333	class	Ig-fold
9333	comment	-
9333	family	Rel
9333	medline	1406630
9333	pazar_tf_id	TF0000076
9333	tax_group	vertebrates
9333	type	SELEX
9334	class	Zinc-coordinating
9334	comment	-
9334	family	Loop-Sheet-Helix
9334	medline	1588974
9334	pazar_tf_id	TF0000077
9334	tax_group	vertebrates
9334	type	SELEX
9335	class	Ig-fold
9335	comment	-
9335	family	Rel
9335	medline	1406630
9335	pazar_tf_id	TF0000078
9335	tax_group	vertebrates
9335	type	SELEX
9336	class	Beta-sheet
9336	comment	-
9336	family	TATA-binding
9336	medline	2329577
9336	tax_group	vertebrates
9337	class	Beta-sheet
9337	comment	column 7 error fixed in version 2
9337	family	TATA-binding
9337	medline	2329577
9337	tax_group	vertebrates
9338	class	Zinc-coordinating
9338	comment	updated matrix sincle last release
9338	family	GATA
9338	medline	12198246
9338	tax_group	vertebrates
9338	type	SELEX
9339	class	Helix-Turn-Helix
9339	comment	updated matrix since last release
9339	family	Homeo
9339	medline	11247607
9339	tax_group	plants
9339	type	SELEX
9340	class	Other
9340	comment	-
9340	family	Other
9340	medline	11165476
9340	pazar_tf_id	TF0000079
9340	tax_group	vertebrates
9340	type	SELEX
9341	class	Zinc-coordinating
9341	comment	-
9341	family	Hormone-nuclear Receptor
9341	medline	15563547
9341	tax_group	vertebrates
9341	type	COMPILED
9342	class	Zinc-coordinating
9342	comment	-
9342	family	Hormone-nuclear Receptor
9342	medline	15563547
9342	tax_group	vertebrates
9342	type	COMPILED
9343	class	Zinc-coordinating
9343	comment	-
9343	family	Hormone-nuclear Receptor
9343	medline	12385991
9343	tax_group	vertebrates
9343	type	COMPILED
9344	class	Zinc-coordinating
9344	comment	heterodimer between NR1H2 and RXR
9344	family	Hormone-nuclear Receptor
9344	medline	10187832
9344	pazar_tf_id	TF0000080
9344	tax_group	vertebrates
9344	type	SELEX
9345	class	Zinc-coordinating
9345	comment	-
9345	family	BetaBetaAlpha-zinc finger
9345	medline	9774661
9345	pazar_tf_id	TF0000081
9345	tax_group	vertebrates
9345	type	SELEX
9346	class	Zipper-Type
9346	comment	-
9346	family	Leucine Zipper
9346	medline	9571165
9346	pazar_tf_id	TF0000082
9346	tax_group	vertebrates
9346	type	SELEX
9347	class	Zinc-coordinating
9347	comment	-
9347	family	BetaBetaAlpha-zinc finger
9347	medline	15661650
9347	tax_group	urochordates
9347	type	SELEX
9348	class	Helix-Turn-Helix::Other
9348	comment	heterodimer between TLX1 and NFIC
9348	family	Homeo::Nuclear Factor I-CCAAT-binding
9348	medline	10327073
9348	pazar_tf_id	TF0000083
9348	tax_group	vertebrates
9348	type	SELEX
9349	class	Zinc-coordinating
9349	comment	-
9349	family	BetaBetaAlpha-zinc finger
9349	medline	15020707
9349	tax_group	plants
9349	type	SELEX
9350	class	Helix-Turn-Helix
9350	comment	-
9350	family	Myb
9350	medline	12215502
9350	tax_group	plants
9350	type	SELEX
9351	class	Helix-Turn-Helix
9351	comment	-
9351	family	Homeo
9351	medline	12746429
9351	pazar_tf_id	TF0000084
9351	tax_group	vertebrates
9351	type	SELEX
9352	class	Beta-Hairpin-Ribbon
9352	comment	-
9352	family	AP2 MBD-like
9352	medline	12368505
9352	tax_group	plants
9352	type	SELEX
9353	class	Helix-Turn-Helix
9353	comment	-
9353	family	Homeo
9353	medline	10871372
9353	pazar_tf_id	TF0000819
9353	tax_group	vertebrates
9353	type	SELEX
9354	class	Helix-Turn-Helix
9354	comment	-
9354	family	Homeo
9354	medline	16997917
9354	pazar_tf_id	TF0000820
9354	tax_group	vertebrates
9354	type	SELEX
9355	class	Zinc-coordinating
9355	comment	-
9355	family	BetaBetaAlpha-zinc finger
9355	medline	10637336
9355	pazar_tf_id	TF0000821
9355	tax_group	insects
9355	type	SELEX
9356	class	Zipper-Type
9356	comment	-
9356	family	Leucine Zipper
9356	medline	9973626
9356	tax_group	plants
9356	type	SELEX
9357	class	Zipper-Type
9357	comment	-
9357	family	Leucine Zipper
9357	medline	10561063
9357	tax_group	plants
9357	type	SELEX
9358	class	Zipper-Type
9358	comment	-
9358	family	Leucine Zipper
9358	medline	10561063
9358	tax_group	plants
9358	type	SELEX
9359	class	Zinc-coordinating
9359	comment	-
9359	family	BetaBetaAlpha-zinc finger
9359	medline	15555547
9359	pazar_tf_id	TF0000822
9359	tax_group	vertebrates
9359	type	SELEX
9360	class	Zinc-coordinating
9360	comment	-
9360	family	BetaBetaAlpha-zinc finger
9360	medline	14752047
9360	pazar_tf_id	TF0000823
9360	tax_group	vertebrates
9360	type	SELEX
9361	class	Helix-Turn-Helix
9361	comment	-
9361	family	Homeo
9361	medline	14704343
9361	pazar_tf_id	TF0000824
9361	tax_group	vertebrates
9361	type	SELEX
9362	class	Other
9362	comment	Multi-protein complex
9362	family	Other
9362	medline	14502648
9362	pazar_tf_id	TF0000825
9362	tax_group	vertebrates
9362	type	SELEX
9363	class	Helix-Turn-Helix
9363	comment	-
9363	family	Homeo
9363	medline	11602361
9363	pazar_tf_id	TF0000827
9363	tax_group	vertebrates
9363	type	SELEX
9364	class	Winged Helix-Turn-Helix
9364	comment	-
9364	family	Ets
9364	medline	16704374
9364	pazar_tf_id	TF0000828
9364	tax_group	vertebrates
9364	type	SELEX
9365	class	Ig-fold
9365	comment	-
9365	family	Stat
9365	medline	17558387
9365	pazar_tf_id	TF0000829
9365	tax_group	vertebrates
9365	type	COMPILED
9366	class	Zinc-coordinating
9366	comment	-
9366	family	BetaBetaAlpha-zinc finger
9366	medline	-
9366	pazar_tf_id	TF0000830
9366	tax_group	vertebrates
9366	type	COMPILED
9367	class	Zinc-coordinating
9367	comment	-
9367	family	BetaBetaAlpha-zinc finger
9367	medline	17512414
9367	pazar_tf_id	TF0000607
9367	tax_group	vertebrates
9367	type	ChiP-seq
9368	class	Zipper-Type
9368	comment	Heterodimer between TAL1 and GATA1. Data is from Frank Grosveld's Lab.
9368	family	Helix-Loop-Helix
9368	medline	-
9368	pazar_tf_id	TF0000022
9368	tax_group	vertebrates
9368	type	ChiP-seq
9369	class	Zinc-coordinating
9369	comment	-
9369	family	Hormone-nuclear Receptor
9369	medline	18555785
9369	pazar_tf_id	-\	
9369	tax_group	vertebrates
9369	type	ChiP-seq
9370	class	Helix-Turn-Helix
9370	comment	-
9370	family	Homeo
9370	medline	18555785
9370	pazar_tf_id	-
9370	tax_group	vertebrates
9370	type	Chip-seq
9371	class	Other Alpha-Helix
9371	comment	-
9371	family	High Mobility Group box (HMG)
9371	medline	18555785
9371	pazar_tf_id	TF0000779
9371	tax_group	vertebrates
9371	type	ChiP-seq
9372	class	Ig-fold
9372	comment	-
9372	family	Stat
9372	medline	18555785
9372	pazar_tf_id	TF0000492
9372	tax_group	vertebrates
9372	type	ChiP-seq
9373	class	Other
9373	comment	-
9373	family	CP2
9373	medline	18555785
9373	pazar_tf_id	-\	
9373	tax_group	vertebrates
9373	type	ChiP-seq
9374	class	Zinc-coordinating
9374	comment	-
9374	family	BetaBetaAlpha-zinc finger
9374	medline	18555785
9374	pazar_tf_id	-\	
9374	tax_group	vertebrates
9374	type	ChiP-seq
9375	class	Zipper-Type
9375	comment	-
9375	family	Helix-Loop-Helix
9375	medline	18555785
9375	pazar_tf_id	TF0000420
9375	tax_group	vertebrates
9375	type	ChiP-seq
9376	class	Winged Helix-Turn-Helix
9376	comment	-
9376	family	Forkhead
9376	medline	18798982
9376	pazar_tf_id	TF0000263
9376	tax_group	vertebrates
9376	type	ChiP-Seq
9377	class	Winged Helix-Turn-Helix
9377	comment	fusion protein between EWSR1 and FLI1 in an oncogenic event.
9377	family	Ets
9377	medline	19305498
9377	pazar_tf_id	TF0000660
9377	tax_group	vertebrates
9377	type	ChiP-seq
9378	class	Winged Helix-Turn-Helix
9378	comment	-
9378	family	Ets
9378	medline	19160518
9378	pazar_tf_id	TF0000039
9378	tax_group	vertebrates
9378	type	ChiP-seq
9379	class	Zinc-coordinating
9379	comment	Data is from Frank Grosveld's Lab.
9379	family	GATA
9379	medline	-
9379	pazar_tf_id	TF0000022
9379	tax_group	vertebrates
9379	type	ChiP-seq
9380	class	Zinc-coordinating
9380	comment	-
9380	family	BetaBetaAlpha-zinc finger
9380	medline	18555785
9380	pazar_tf_id	TF0000026
9380	tax_group	vertebrates
9380	type	ChiP-seq
9381	class	Zinc-coordinating
9381	comment	-
9381	family	BetaBetaAlpha-zinc finger
9381	medline	17540862
9381	pazar_tf_id	TF0000830
9381	tax_group	vertebrates
9381	type	Chip-seq
9382	class	Ig-fold
9382	comment	Data is from Frank Grosveld's Lab.
9382	family	Runt
9382	medline	-
9382	pazar_tf_id	TF0000001
9382	tax_group	vertebrates
9382	type	ChiP-seq
9383	class	Ig-fold
9383	comment	-
9383	family	Stat
9383	medline	17558387
9383	pazar_tf_id	TF0000829
9383	tax_group	vertebrates
9383	type	ChiP-seq
9384	class	Zipper-Type
9384	comment	-
9384	family	Helix-Loop-Helix
9384	medline	18555785
9384	pazar_tf_id	TF0000075
9384	tax_group	vertebrates
9384	type	ChiP-Seq
9385	class	Winged Helix-Turn-Helix
9385	comment	-
9385	family	Forkhead
9385	medline	19553195
9385	pazar_tf_id	TF0000029
9385	tax_group	vertebrates
9385	type	ChiP-seq
9386	class	Zinc-coordinating
9386	comment	-
9386	family	Hormone-nuclear Receptor
9386	medline	19339991
9386	pazar_tf_id	TF0000189
9386	tax_group	vertebrates
9386	type	ChiP-seq
9387	class	Zinc-coordinating
9387	comment	Heterodimer between PPARG and RXRA
9387	family	Hormone-nuclear Receptor
9387	medline	18981474
9387	pazar_tf_id	TF0000041
9387	tax_group	vertebrates
9387	type	ChiP-seq
9388	class	Zipper-Type
9388	comment	Annotations from PAZAR NFE2L2(NRF2) in the AREs project (TF0000699).
9388	family	Leucine Zipper
9388	medline	17916232
9388	pazar_tf_id	TF0000699
9388	tax_group	vertebrates
9388	type	COMPILED
9389	class	Helix-Turn-Helix
9389	comment	Annotations from PAZAR ARID3A_MOUSE in the TFe project (TF0000816).
9389	family	Arid
9389	medline	8543152
9389	pazar_tf_id	TF0000816
9389	tax_group	vertebrates
9389	type	SELEX
9390	class	Ig-fold
9390	comment	Annotations from PAZAR NFAT1_MOUSE + NFAT1_HUMAN + NFAT1_RAT (TF0000191, TF0000193, TF0000195) in the pleiades genes project.
9390	family	Rel
9390	medline	17916232
9390	pazar_tf_id	TF0000193
9390	tax_group	vertebrates
9390	type	COMPILED
9391	class	Helix-Turn-Helix
9391	comment	Annotations from PAZAR HNF1B_HUMAN + HNF1B_MOUSE (TF0000780, TF0000782) in the TFe project.
9391	family	Homeo
9391	medline	17916232
9391	pazar_tf_id	TF0000780
9391	tax_group	vertebrates
9391	type	COMPILED
9392	class	Zipper-Type
9392	comment	Annotations from PAZAR EBF1_MOUSE (TF0000762) in the Olf_Ebf_TFBS project.
9392	family	Helix-Loop-Helix
9392	medline	17916232
9392	pazar_tf_id	TF0000762
9392	tax_group	vertebrates
9392	type	COMPILED
9393	class	Zinc-coordinating
9393	comment	Annotations from PAZAR INSM1_HUMAN (TF0000773) in the TFe project.
9393	family	BetaBetaAlpha-zinc finger
9393	medline	17916232
9393	pazar_tf_id	TF0000773
9393	tax_group	vertebrates
9393	type	COMPILED
9394	class	Winged Helix-Turn-Helix
9394	comment	Annotations from PAZAR FEV_RAT + FEV_HUMAN (TF0000158, TF0000163) in the pleiades genes project.
9394	family	Ets
9394	medline	17916232
9394	pazar_tf_id	TF0000163
9394	tax_group	vertebrates
9394	type	COMPILED
9395	class	Winged Helix-Turn-Helix
9395	comment	Annotations from PAZAR FOXO3_MOUSE + FOXO3_HUMAN (TF0000811, TF0000812) in the TFe project.
9395	family	Forkhead
9395	medline	17916232
9395	pazar_tf_id	-
9395	tax_group	vertebrates
9395	type	COMPILED
9396	class	Helix-Turn-Helix
9396	comment	Annotations from PAZAR HOXA5_MOUSE + HOXA5_HUMAN (TF0000293, TF0000501) in the pleiades genes project.
9396	family	Homeo
9396	medline	17916232
9396	pazar_tf_id	TF0000501
9396	tax_group	vertebrates
9396	type	COMPILED
9397	class	Zinc-coordinating
9397	comment	Dimer. Annotations from PAZAR RXR/RAR_HUMAN (TF0000788) in the RARE project.
9397	family	Hormone-nuclear Receptor
9397	medline	17916232
9397	pazar_tf_id	TF0000788
9397	tax_group	vertebrates
9397	type	COMPILED
9398	class	Zinc-coordinating
9398	comment	Annotations from PAZAR NR4A2_MOUSE + NR4A2_RAT + NR4A2_HUMAN (TF0000135, TF0000153, TF0000157) in the pleiades genes project.
9398	family	Hormone-nuclear Receptor
9398	medline	17916232
9398	pazar_tf_id	TF0000135
9398	tax_group	vertebrates
9398	type	COMPILED
9399	class	Other
9399	comment	Half-site reported based on MEME analysis of SELEX sequences
9399	family	NFI CCAAT-binding
9399	medline	12101405
9399	pazar_tf_id	TF0000368
9399	tax_group	vertebrates
9399	type	High-throughput SELEX SAGE
9400	class	Zinc-coordinating
9400	comment	aka Zif268
9400	family	BetaBetaAlpha-zinc finger
9400	medline	16041365
9400	pazar_tf_id	TF0000345
9400	tax_group	vertebrates
9400	type	bacterial 1-hybrid
9401	class	Zinc-coordinating
9401	family	BetaBetaAlpha-zinc finger
9401	medline	16041365
9401	pazar_tf_id	-
9401	tax_group	vertebrates
9401	type	bacterial 1-hybrid
9402	class	Zinc-coordinating
9402	family	Hormone-nuclear Receptor
9402	medline	15634773
9402	pazar_tf_id	-
9402	tax_group	vertebrates
9402	type	SELEX
9403	class	Winged Helix-Turn-Helix
9403	comment	Annotations from PAZAR PU.1 in the pleiades genes project (TF0000134).
9403	family	Ets
9403	medline	17916232
9403	pazar_tf_id	TF0000056
9403	tax_group	vertebrates
9403	type	COMPILED
9404	class	Zipper-Type
9404	comment	Annotations from PAZAR CREB1_RAT + CREB1_HUMAN + CREB1_MOUSE in the pleiades genes project (TF0000110, TF0000150, TF0000732).
9404	family	Leucine Zipper
9404	medline	17916232
9404	pazar_tf_id	TF0000013
9404	tax_group	vertebrates
9404	type	COMPILED
9405	class	Zipper-Type
9405	comment	Dimer. Annotations from PAZAR C-JUN + JUN_RAT + JUN_MOUSE + JUN_HUMAN + FOS/JUN_HUMAN + FOS_HUMAN in the pleiades genes project (TF0000129, TF0000147, TF0000234, TF0000243, TF0000670, TF0000287).
9405	family	Leucine Zipper
9405	medline	17916232
9405	pazar_tf_id	TF0000071
9405	tax_group	vertebrates
9405	type	COMPILED
9406	class	Zinc-coordinating
9406	comment	Annotations from PAZAR SP1 + SP1_MOUSE + SP1_HUMAN + SP1_RAT in the pleiades genes project (TF0000105, TF0000121, TF0000137, TF0000146).
9406	family	BetaBetaAlpha-zinc finger
9406	medline	17916232
9406	pazar_tf_id	TF0000055
9406	tax_group	vertebrates
9406	type	COMPILED
9407	class	Zipper-Type
9407	comment	last 3 nt removed
9407	family	Leucine Zipper
9407	medline	1672737
9407	tax_group	vertebrates
9407	type	COMPILED
9408	class	Helix-Turn-Helix
9408	comment	-
9408	family	Homeo
9408	medline	18332042
9408	tax_group	insects
9408	type	bacterial 1-hybrid
9409	class	Helix-Turn-Helix
9409	comment	-
9409	family	Homeo
9409	medline	18332042
9409	tax_group	insects
9409	type	bacterial 1-hybrid
9410	class	Helix-Turn-Helix
9410	comment	-
9410	family	Homeo
9410	medline	18332042
9410	tax_group	insects
9410	type	bacterial 1-hybrid
9411	class	Helix-Turn-Helix
9411	comment	-
9411	family	Homeo
9411	medline	18332042
9411	tax_group	insects
9411	type	bacterial 1-hybrid
9412	class	Helix-Turn-Helix
9412	comment	-
9412	family	Homeo
9412	medline	18332042
9412	tax_group	insects
9412	type	bacterial 1-hybrid
9413	class	Helix-Turn-Helix
9413	comment	-
9413	family	Homeo
9413	medline	18332042
9413	tax_group	insects
9413	type	bacterial 1-hybrid
9414	class	Helix-Turn-Helix
9414	comment	-
9414	family	Homeo
9414	medline	18332042
9414	tax_group	insects
9414	type	bacterial 1-hybrid
9415	class	Helix-Turn-Helix
9415	comment	-
9415	family	Homeo
9415	medline	18332042
9415	tax_group	insects
9415	type	bacterial 1-hybrid
9416	class	Helix-Turn-Helix
9416	comment	-
9416	family	Homeo
9416	medline	18332042
9416	tax_group	insects
9416	type	bacterial 1-hybrid
9417	class	Helix-Turn-Helix
9417	comment	formerly CG12361
9417	family	Homeo
9417	medline	18332042
9417	tax_group	insects
9417	type	bacterial 1-hybrid
9418	class	Helix-Turn-Helix
9418	comment	-
9418	family	Homeo
9418	medline	18332042
9418	tax_group	insects
9418	type	bacterial 1-hybrid
9419	class	Helix-Turn-Helix
9419	comment	-
9419	family	Homeo
9419	medline	18332042
9419	tax_group	insects
9419	type	bacterial 1-hybrid
9420	class	Helix-Turn-Helix
9420	comment	-
9420	family	Homeo
9420	medline	18332042
9420	tax_group	insects
9420	type	bacterial 1-hybrid
9421	class	Helix-Turn-Helix
9421	comment	-
9421	family	Homeo
9421	medline	18332042
9421	tax_group	insects
9421	type	bacterial 1-hybrid
9422	class	Helix-Turn-Helix
9422	comment	-
9422	family	Homeo
9422	medline	18332042
9422	tax_group	insects
9422	type	bacterial 1-hybrid
9423	class	Helix-Turn-Helix
9423	comment	-
9423	family	Homeo
9423	medline	18585360
9423	tax_group	insects
9423	type	bacterial 1-hybrid
9424	class	Helix-Turn-Helix
9424	comment	-
9424	family	Homeo
9424	medline	18332042
9424	tax_group	insects
9424	type	bacterial 1-hybrid
9425	class	Helix-Turn-Helix
9425	comment	-
9425	family	Homeo
9425	medline	18332042
9425	tax_group	insects
9425	type	bacterial 1-hybrid
9426	class	Helix-Turn-Helix
9426	comment	-
9426	family	Homeo
9426	medline	18585360
9426	tax_group	insects
9426	type	bacterial 1-hybrid
9427	class	Helix-Turn-Helix
9427	comment	-
9427	family	Homeo
9427	medline	18332042
9427	tax_group	insects
9427	type	bacterial 1-hybrid
9428	class	Other Alpha-Helix
9428	comment	-
9428	family	Sand
9428	medline	15572468
9428	tax_group	insects
9428	type	DNaseI footprinting
9429	class	Helix-Turn-Helix
9429	comment	-
9429	family	Homeo
9429	medline	18332042
9429	tax_group	insects
9429	type	bacterial 1-hybrid
9430	class	Helix-Turn-Helix
9430	comment	-
9430	family	Homeo
9430	medline	18585360
9430	tax_group	insects
9430	type	bacterial 1-hybrid
9431	class	Helix-Turn-Helix
9431	comment	-
9431	family	Homeo
9431	medline	18332042
9431	tax_group	insects
9431	type	bacterial 1-hybrid
9432	class	Helix-Turn-Helix
9432	comment	-
9432	family	Homeo
9432	medline	18332042
9432	tax_group	insects
9432	type	bacterial 1-hybrid
9433	class	Helix-Turn-Helix
9433	comment	-
9433	family	Homeo
9433	medline	18332042
9433	tax_group	insects
9433	type	bacterial 1-hybrid
9434	class	Helix-Turn-Helix
9434	comment	-
9434	family	Homeo
9434	medline	18332042
9434	tax_group	insects
9434	type	bacterial 1-hybrid
9435	class	Helix-Turn-Helix
9435	comment	-
9435	family	Homeo
9435	medline	18332042
9435	tax_group	insects
9435	type	bacterial 1-hybrid
9436	class	Helix-Turn-Helix
9436	comment	-
9436	family	Homeo
9436	medline	18332042
9436	tax_group	insects
9436	type	bacterial 1-hybrid
9437	class	Helix-Turn-Helix
9437	comment	-
9437	family	Homeo
9437	medline	18332042
9437	tax_group	insects
9437	type	bacterial 1-hybrid
9438	class	Helix-Turn-Helix
9438	comment	-
9438	family	Homeo
9438	medline	18332042
9438	tax_group	insects
9438	type	bacterial 1-hybrid
9439	class	Helix-Turn-Helix
9439	comment	-
9439	family	Homeo
9439	medline	18332042
9439	tax_group	insects
9439	type	bacterial 1-hybrid
9440	class	Helix-Turn-Helix
9440	comment	-
9440	family	Homeo
9440	medline	18585360
9440	tax_group	insects
9440	type	bacterial 1-hybrid
9441	class	Helix-Turn-Helix
9441	comment	-
9441	family	Homeo
9441	medline	18332042
9441	tax_group	insects
9441	type	bacterial 1-hybrid
9442	class	Helix-Turn-Helix
9442	comment	-
9442	family	Homeo
9442	medline	18332042
9442	tax_group	insects
9442	type	bacterial 1-hybrid
9443	class	Helix-Turn-Helix
9443	comment	-
9443	family	Homeo
9443	medline	18332042
9443	tax_group	insects
9443	type	bacterial 1-hybrid
9444	class	Helix-Turn-Helix
9444	comment	-
9444	family	Homeo
9444	medline	18585360
9444	tax_group	insects
9444	type	bacterial 1-hybrid
9445	class	Helix-Turn-Helix
9445	comment	-
9445	family	Homeo
9445	medline	18332042
9445	tax_group	insects
9445	type	bacterial 1-hybrid
9446	class	Helix-Turn-Helix
9446	comment	-
9446	family	Homeo
9446	medline	18332042
9446	tax_group	insects
9446	type	bacterial 1-hybrid
9447	class	Helix-Turn-Helix
9447	comment	-
9447	family	Homeo
9447	medline	18332042
9447	tax_group	insects
9447	type	bacterial 1-hybrid
9448	class	Zinc-coordinating
9448	comment	-
9448	family	BetaBetaAlpha-zinc finger
9448	medline	15572468
9448	tax_group	insects
9448	type	DNaseI footprinting
9449	class	Helix-Turn-Helix
9449	comment	-
9449	family	Homeo
9449	medline	18332042
9449	tax_group	insects
9449	type	bacterial 1-hybrid
9450	class	Helix-Turn-Helix
9450	comment	-
9450	family	Homeo
9450	medline	18332042
9450	tax_group	insects
9450	type	bacterial 1-hybrid
9451	class	Helix-Turn-Helix
9451	comment	-
9451	family	Homeo
9451	medline	18585360
9451	tax_group	insects
9451	type	bacterial 1-hybrid
9452	class	Helix-Turn-Helix
9452	comment	-
9452	family	Homeo
9452	medline	18332042
9452	tax_group	insects
9452	type	bacterial 1-hybrid
9453	class	Helix-Turn-Helix
9453	comment	-
9453	family	Homeo
9453	medline	18332042
9453	tax_group	insects
9453	type	bacterial 1-hybrid
9454	class	Helix-Turn-Helix
9454	comment	-
9454	family	Homeo
9454	medline	18332042
9454	tax_group	insects
9454	type	bacterial 1-hybrid
9455	class	Helix-Turn-Helix
9455	comment	-
9455	family	Homeo
9455	medline	18332042
9455	tax_group	insects
9455	type	bacterial 1-hybrid
9456	class	Helix-Turn-Helix
9456	family	Brinker
9456	medline	15572468
9456	tax_group	insects
9456	type	DNaseI footprinting
9457	class	Helix-Turn-Helix
9457	comment	-
9457	family	Homeo
9457	medline	18332042
9457	tax_group	insects
9457	type	bacterial 1-hybrid
9458	class	Helix-Turn-Helix
9458	comment	-
9458	family	Homeo
9458	medline	18332042
9458	tax_group	insects
9458	type	bacterial 1-hybrid
9459	class	Helix-Turn-Helix
9459	comment	-
9459	family	Homeo
9459	medline	18332042
9459	tax_group	insects
9459	type	bacterial 1-hybrid
9460	class	Helix-Turn-Helix
9460	comment	-
9460	family	Homeo
9460	medline	18332042
9460	tax_group	insects
9460	type	bacterial 1-hybrid
9461	class	Helix-Turn-Helix
9461	comment	-
9461	family	Homeo
9461	medline	18332042
9461	tax_group	insects
9461	type	bacterial 1-hybrid
9462	class	Helix-Turn-Helix
9462	comment	-
9462	family	Homeo
9462	medline	18332042
9462	tax_group	insects
9462	type	bacterial 1-hybrid
9463	class	Helix-Turn-Helix
9463	comment	-
9463	family	Homeo
9463	medline	18332042
9463	tax_group	insects
9463	type	bacterial 1-hybrid
9464	class	Helix-Turn-Helix
9464	comment	-
9464	family	Homeo
9464	medline	18332042
9464	tax_group	insects
9464	type	bacterial 1-hybrid
9465	class	Helix-Turn-Helix
9465	comment	-
9465	family	Homeo
9465	medline	18585360
9465	tax_group	insects
9465	type	bacterial 1-hybrid
10579	type	ChiP-seq
10579	class	Zinc-coordinating
10757	tfbs_shape_id	369
10756	tfbs_shape_id	368
9467	class	Helix-Turn-Helix
9467	comment	-
9467	family	Homeo
9467	medline	18585360
9467	tax_group	insects
9467	type	bacterial 1-hybrid
9468	class	Helix-Turn-Helix
9468	comment	-
9468	family	Homeo
9468	medline	18332042
9468	tax_group	insects
9468	type	bacterial 1-hybrid
9469	class	Helix-Turn-Helix
9469	comment	-
9469	family	Homeo
9469	medline	18332042
9469	tax_group	insects
9469	type	bacterial 1-hybrid
9470	class	Helix-Turn-Helix
9470	comment	-
9470	family	Homeo
9470	medline	18332042
9470	tax_group	insects
9470	type	bacterial 1-hybrid
9471	class	Helix-Turn-Helix
9471	comment	-
9471	family	Homeo
9471	medline	18332042
9471	tax_group	insects
9471	type	bacterial 1-hybrid
9472	class	Helix-Turn-Helix
9472	comment	-
9472	family	Homeo
9472	medline	18585360
9472	tax_group	insects
9472	type	bacterial 1-hybrid
9473	class	Helix-Turn-Helix
9473	comment	-
9473	family	Homeo
9473	medline	18332042
9473	tax_group	insects
9473	type	bacterial 1-hybrid
9474	class	Helix-Turn-Helix
9474	comment	-
9474	family	Homeo
9474	medline	18332042
9474	tax_group	insects
9474	type	bacterial 1-hybrid
9475	class	Helix-Turn-Helix
9475	comment	-
9475	family	Homeo
9475	medline	18332042
9475	tax_group	insects
9475	type	bacterial 1-hybrid
9476	class	Helix-Turn-Helix
9476	comment	-
9476	family	Homeo
9476	medline	18332042
9476	tax_group	insects
9476	type	bacterial 1-hybrid
9477	class	Helix-Turn-Helix
9477	comment	-
9477	family	Homeo
9477	medline	18332042
9477	tax_group	insects
9477	type	bacterial 1-hybrid
9478	class	Helix-Turn-Helix
9478	comment	-
9478	family	Homeo
9478	medline	18332042
9478	tax_group	insects
9478	type	bacterial 1-hybrid
9479	class	Helix-Turn-Helix
9479	comment	-
9479	family	Homeo
9479	medline	18332042
9479	tax_group	insects
9479	type	bacterial 1-hybrid
9480	class	Other Alpha-Helix
9480	comment	-
9480	family	High Mobility Group box (HMG)
9480	medline	15572468
9480	tax_group	insects
9480	type	DNaseI footprinting
9481	class	Helix-Turn-Helix
9481	comment	-
9481	family	Homeo
9481	medline	18332042
9481	tax_group	insects
9481	type	bacterial 1-hybrid
9482	class	Helix-Turn-Helix
9482	comment	-
9482	family	Homeo
9482	medline	16041365
9482	tax_group	insects
9482	type	bacterial 1-hybrid
9483	class	Helix-Turn-Helix
9483	comment	-
9483	family	Homeo
9483	medline	18332042
9483	tax_group	insects
9483	type	bacterial 1-hybrid
9484	class	Helix-Turn-Helix
9484	comment	-
9484	family	Homeo
9484	medline	18332042
9484	tax_group	insects
9484	type	bacterial 1-hybrid
9485	class	Ig-fold
9485	comment	Bgb is the co-activator with CBF-beta domain
9485	family	Runt
9485	medline	16041365
9485	tax_group	insects
9485	type	bacterial 1-hybrid
9486	class	Helix-Turn-Helix
9486	comment	-
9486	family	Homeo
9486	medline	15572468
9486	tax_group	insects
9486	type	DNaseI footprinting
9487	class	Zinc-coordinating
9487	comment	-
9487	family	BetaBetaAlpha-zinc finger
9487	medline	15572468
9487	tax_group	insects
9487	type	DNaseI footprinting
9488	class	Helix-Turn-Helix
9488	comment	-
9488	family	Homeo
9488	medline	18332042
9488	tax_group	insects
9488	type	bacterial 1-hybrid
9489	class	Helix-Turn-Helix
9489	comment	-
9489	family	Homeo
9489	medline	18332042
9489	tax_group	insects
9489	type	bacterial 1-hybrid
9490	class	Helix-Turn-Helix
9490	comment	-
9490	family	Homeo
9490	medline	18585360
9490	tax_group	insects
9490	type	bacterial 1-hybrid
9491	class	Helix-Turn-Helix
9491	comment	-
9491	family	Homeo
9491	medline	18332042
9491	tax_group	insects
9491	type	bacterial 1-hybrid
9492	class	Zipper-type
9492	comment	-
9492	family	Helix-Loop-Helix
9492	medline	15572468
9492	tax_group	insects
9492	type	DNaseI footprinting
9493	class	Helix-Turn-Helix
9493	comment	-
9493	family	Homeo
9493	medline	18332042
9493	tax_group	insects
9493	type	bacterial 1-hybrid
9494	class	Helix-Turn-Helix
9494	comment	-
9494	family	Homeo
9494	medline	18332042
9494	tax_group	insects
9494	type	bacterial 1-hybrid
9495	class	Helix-Turn-Helix
9495	comment	-
9495	family	Homeo
9495	medline	18332042
9495	tax_group	insects
9495	type	bacterial 1-hybrid
9496	class	Helix-Turn-Helix
9496	comment	-
9496	family	Homeo
9496	medline	18585360
9496	tax_group	insects
9496	type	bacterial 1-hybrid
9497	class	Helix-Turn-Helix
9497	comment	-
9497	family	Homeo
9497	medline	15572468
9497	tax_group	insects
9497	type	DNaseI footprinting
9498	class	Helix-Turn-Helix
9498	comment	-
9498	family	Zeste
9498	medline	15572468
9498	tax_group	insects
9498	type	DNaseI footprinting
9499	class	Helix-Turn-Helix
9499	comment	-
9499	family	Homeo
9499	medline	18332042
9499	tax_group	insects
9499	type	bacterial 1-hybrid
9500	class	Helix-Turn-Helix
9500	comment	-
9500	family	Homeo
9500	medline	18332042
9500	tax_group	insects
9500	type	bacterial 1-hybrid
9501	class	Helix-Turn-Helix
9501	comment	-
9501	family	Homeo
9501	medline	18585360
9501	tax_group	insects
9501	type	bacterial 1-hybrid
9502	class	Zinc-coordinating
9502	comment	-
9502	family	Hormone-nuclear Receptor
9502	medline	18272478
9502	tax_group	vertebrates
9502	type	ChIP-chip
9503	class	Zipper-Type
9503	comment	dimer between HIF1A and ARNT
9503	family	Helix-Loop-Helix
9503	medline	16234508
9503	tax_group	vertebrates
9503	type	COMPILED
9504	class	Zinc-coordinating
9504	comment	-
9504	family	BetaBetaAlpha-zinc finger
9504	medline	17606643
9504	tax_group	nematodes
9504	type	COMPILED
9505	class	Other
9505	comment	-
9505	family	Other
9505	medline	16314527
9505	tax_group	nematodes
9505	type	SELEX
9506	class	Zinc-coordinating
9506	comment	-
9506	family	DM
9506	medline	9927589
9506	tax_group	nematodes
9506	type	EMSA
9507	class	Helix-Turn-Helix
9507	comment	dimer
9507	family	Homeo
9507	medline	15177025
9507	tax_group	nematodes
9507	type	EMSA
9508	class	Helix-Turn-Helix
9508	comment	NK-2 class; ortholog to Drosophila tinman and vertebrate Nkx2-5
9508	family	Homeo
9508	medline	16998473
9508	tax_group	nematodes
9508	type	PBM
9509	class	Zinc-coordinating
9509	family	BetaBetaAlpha-zinc finger
9509	medline	19111667
9509	tax_group	fungi
9509	type	PBM, CSA and/or DIP-chip
9510	class	Other Alpha-Helix
9510	family	High Mobility Group box (HMG)
9510	medline	19111667
9510	tax_group	fungi
9510	type	PBM, CSA and/or DIP-chip
9511	class	Zinc-coordinating
9511	family	BetaBetaAlpha-zinc finger
9511	medline	19111667
9511	tax_group	fungi
9511	type	PBM, CSA and/or DIP-chip
9512	class	Zinc-coordinating
9512	family	BetaBetaAlpha-zinc finger
9512	medline	19111667
9512	tax_group	fungi
9512	type	PBM, CSA and/or DIP-chip
9513	class	Other
9513	family	Other
9513	medline	18842628
9513	tax_group	fungi
9513	type	PBM
9514	class	Other
9514	family	Other
9514	medline	19111667
9514	tax_group	fungi
9514	type	PBM, CSA and/or DIP-chip
9515	class	Other Alpha-Helix
9515	family	MADS
9515	medline	16522208
9515	tax_group	fungi
9515	type	ChIP-on-chip
9516	class	Zinc-coordinating
9516	family	Fungal Zn cluster
9516	medline	16522208
9516	tax_group	fungi
9516	type	ChIP-on-chip
9517	class	Zinc-coordinating
9517	family	Fungal Zn cluster
9517	medline	18842628
9517	tax_group	fungi
9517	type	PBM
9518	class	Zipper-Type
9518	family	Leucine Zipper
9518	medline	16522208
9518	tax_group	fungi
9518	type	ChIP-on-chip
9519	class	Zinc-coordinating
9519	family	Fungal Zn cluster
9519	medline	19111667
9519	tax_group	fungi
9519	type	PBM, CSA and/or DIP-chip
9520	class	Zinc-coordinating
9520	family	GATA
9520	medline	16522208
9520	tax_group	fungi
9520	type	ChIP-on-chip
9521	class	Zinc-coordinating
9521	family	BetaBetaAlpha-zinc finger
9521	medline	19111667
9521	tax_group	fungi
9521	type	PBM, CSA and/or DIP-chip
9522	class	Helix-Turn-Helix
9522	family	Myb
9522	medline	18842628
9522	tax_group	fungi
9522	type	PBM
9523	class	Zipper-Type
9523	family	Leucine Zipper
9523	medline	17130146
9523	tax_group	fungi
9523	type	COMPILED
9524	class	Zinc-coordinating
9524	family	Fungal Zn cluster
9524	medline	19111667
9524	tax_group	fungi
9524	type	PBM, CSA and/or DIP-chip
9525	class	Zipper-Type
9525	family	Helix-Loop-Helix
9525	medline	19111667
9525	tax_group	fungi
9525	type	PBM, CSA and/or DIP-chip
9526	class	Zinc-coordinating
9526	family	Fungal Zn cluster
9526	medline	19111667
9526	tax_group	fungi
9526	type	PBM, CSA and/or DIP-chip
9527	class	Zinc-coordinating
9527	family	Fungal Zn cluster
9527	medline	19111667
9527	tax_group	fungi
9527	type	PBM, CSA and/or DIP-chip
9528	class	Zipper-Type
9528	family	Leucine Zipper
9528	medline	19111667
9528	tax_group	fungi
9528	type	PBM, CSA and/or DIP-chip
9529	class	Zinc-coordinating
9529	family	BetaBetaAlpha-zinc finger
9529	medline	19111667
9529	tax_group	fungi
9529	type	PBM, CSA and/or DIP-chip
9530	class	Zipper-Type
9530	family	Leucine Zipper
9530	medline	19111667
9530	tax_group	fungi
9530	type	PBM, CSA and/or DIP-chip
9531	class	Zinc-coordinating
9531	family	Copper fist
9531	medline	17130146
9531	tax_group	fungi
9531	type	COMPILED
9532	class	Helix-Turn-Helix
9532	family	Homeo
9532	medline	19111667
9532	tax_group	fungi
9532	type	PBM, CSA and/or DIP-chip
9533	class	Zinc-coordinating
9533	family	GATA
9533	medline	19111667
9533	tax_group	fungi
9533	type	PBM, CSA and/or DIP-chip
9534	class	Zinc-coordinating
9534	family	Fungal Zn cluster
9534	medline	16522208
9534	tax_group	fungi
9534	type	ChIP-on-chip
9535	class	Other
9535	family	Other
9535	medline	19111667
9535	tax_group	fungi
9535	type	PBM, CSA and/or DIP-chip
9536	class	Zinc-coordinating
9536	family	Fungal Zn cluster
9536	medline	19111667
9536	tax_group	fungi
9536	type	PBM, CSA and/or DIP-chip
9537	class	Zinc-coordinating
9537	family	GATA
9537	medline	19111667
9537	tax_group	fungi
9537	type	PBM, CSA and/or DIP-chip
9538	class	Zinc-coordinating
9538	family	Fungal Zn cluster
9538	medline	19111667
9538	tax_group	fungi
9538	type	PBM, CSA and/or DIP-chip
9539	class	Winged Helix-Turn-Helix
9539	family	Forkhead
9539	medline	19111667
9539	tax_group	fungi
9539	type	PBM, CSA and/or DIP-chip
9540	class	Winged Helix-Turn-Helix
9540	family	Forkhead
9540	medline	18842628
9540	tax_group	fungi
9540	type	PBM
9541	class	Winged Helix-Turn-Helix
9541	family	Forkhead
9541	medline	19111667
9541	tax_group	fungi
9541	type	PBM, CSA and/or DIP-chip
9542	class	Zinc-coordinating
9542	family	BetaBetaAlpha-zinc finger
9542	medline	19111667
9542	tax_group	fungi
9542	type	PBM, CSA and/or DIP-chip
9543	class	Zinc-coordinating
9543	family	Fungal Zn cluster
9543	medline	18842628
9543	tax_group	fungi
9543	type	PBM
9544	class	Zinc-coordinating
9544	family	GATA
9544	medline	19111667
9544	tax_group	fungi
9544	type	PBM, CSA and/or DIP-chip
9545	class	Zinc-coordinating
9545	family	GATA
9545	medline	19111667
9545	tax_group	fungi
9545	type	PBM, CSA and/or DIP-chip
9546	class	Zinc-coordinating
9546	family	GATA
9546	medline	19111667
9546	tax_group	fungi
9546	type	PBM, CSA and/or DIP-chip
9547	class	Zipper-Type
9547	family	Leucine Zipper
9547	medline	18842628
9547	tax_group	fungi
9547	type	PBM
9548	class	Other
9548	family	Other
9548	medline	10487868
9548	tax_group	fungi
9548	type	COMPILED
9549	class	Other
9549	family	Other
9549	medline	16522208
9549	tax_group	fungi
9549	type	ChIP-on-chip
9550	class	Zinc-coordinating
9550	family	BetaBetaAlpha-zinc finger
9550	medline	19111667
9550	tax_group	fungi
9550	type	PBM, CSA and/or DIP-chip
9551	class	Zinc-coordinating
9551	family	GATA
9551	medline	19111667
9551	tax_group	fungi
9551	type	PBM, CSA and/or DIP-chip
9552	class	Zinc-coordinating
9552	family	Fungal Zn cluster
9552	medline	18842628
9552	tax_group	fungi
9552	type	PBM
9553	class	Zinc-coordinating
9553	family	GATA
9553	medline	19111667
9553	tax_group	fungi
9553	type	PBM, CSA and/or DIP-chip
9554	class	Zipper-Type
9554	family	Leucine Zipper
9554	medline	19111667
9554	tax_group	fungi
9554	type	PBM, CSA and/or DIP-chip
9555	class	Zinc-coordinating
9555	family	Fungal Zn cluster
9555	medline	19111667
9555	tax_group	fungi
9555	type	PBM, CSA and/or DIP-chip
9556	class	Zinc-coordinating
9556	family	Fungal Zn cluster
9556	medline	19111667
9556	tax_group	fungi
9556	type	PBM, CSA and/or DIP-chip
9557	class	Other Alpha-Helix
9557	family	NFY CCAAT-binding
9557	medline	17130146
9557	tax_group	fungi
9557	type	COMPILED
9558	class	Other Alpha-Helix
9558	family	NFY CCAAT-binding
9558	medline	17130146
9558	tax_group	fungi
9558	type	COMPILED
9559	class	Other Alpha-Helix
9559	family	NFY CCAAT-binding
9559	medline	16522208
9559	tax_group	fungi
9559	type	ChIP-on-chip
9560	class	Other Alpha-Helix
9560	family	NFY CCAAT-binding
9560	medline	17130146
9560	tax_group	fungi
9560	type	COMPILED
9561	class	Winged Helix-Turn-Helix
9561	family	Forkhead
9561	medline	19111667
9561	tax_group	fungi
9561	type	PBM, CSA and/or DIP-chip
9562	class	Helix-Turn-Helix
9562	family	Homeo
9562	medline	19111667
9562	tax_group	fungi
9562	type	PBM, CSA and/or DIP-chip
9563	class	Winged Helix-Turn-Helix
9563	family	E2F
9563	medline	19111667
9563	tax_group	fungi
9563	type	PBM, CSA and/or DIP-chip
9564	class	Other
9564	family	Other
9564	medline	16522208
9564	tax_group	fungi
9564	type	ChIP-on-chip
9565	class	Zipper-Type
9565	family	Helix-Loop-Helix
9565	medline	16522208
9565	tax_group	fungi
9565	type	ChIP-on-chip
9566	class	Zipper-Type
9566	family	Helix-Loop-Helix
9566	medline	16522208
9566	tax_group	fungi
9566	type	ChIP-on-chip
9567	class	Other Alpha-Helix
9567	family	High Mobility Group box (HMG)
9567	medline	16522208
9567	tax_group	fungi
9567	type	ChIP-on-chip
9568	class	Zinc-coordinating
9568	family	Fungal Zn cluster
9568	medline	19111667
9568	tax_group	fungi
9568	type	PBM, CSA and/or DIP-chip
9569	class	Zinc-coordinating
9569	family	Fungal Zn cluster
9569	medline	19111667
9569	tax_group	fungi
9569	type	PBM, CSA and/or DIP-chip
9570	class	Zinc-coordinating
9570	family	Copper fist
9570	medline	17130146
9570	tax_group	fungi
9570	type	COMPILED
9571	class	Helix-Turn-Helix
9571	family	Homeo
9571	medline	16522208
9571	tax_group	fungi
9571	type	ChIP-on-chip
9572	class	Helix-Turn-Helix
9572	family	Homeo
9572	medline	10487868
9572	tax_group	fungi
9572	type	COMPILED
9573	class	Ig-fold
9573	family	Rel
9573	medline	19111667
9573	tax_group	fungi
9573	type	PBM, CSA and/or DIP-chip
9574	class	Ig-fold
9574	family	Rel
9574	medline	17130146
9574	tax_group	fungi
9574	type	COMPILED
9575	class	Other Alpha-Helix
9575	family	MADS
9575	medline	17130146
9575	tax_group	fungi
9575	type	COMPILED
9576	class	Zipper-Type
9576	family	Leucine Zipper
9576	medline	16522208
9576	tax_group	fungi
9576	type	ChIP-on-chip
9577	class	Zinc-coordinating
9577	family	BetaBetaAlpha-zinc finger
9577	medline	19111667
9577	tax_group	fungi
9577	type	PBM, CSA and/or DIP-chip
9578	class	Zinc-coordinating
9578	family	BetaBetaAlpha-zinc finger
9578	medline	19111667
9578	tax_group	fungi
9578	type	PBM, CSA and/or DIP-chip
9579	class	Zipper-Type
9579	family	Leucine Zipper
9579	medline	16522208
9579	tax_group	fungi
9579	type	ChIP-on-chip
9580	class	Winged Helix-Turn-Helix
9580	family	E2F
9580	medline	18842628
9580	tax_group	fungi
9580	type	PBM
9581	class	Zinc-coordinating
9581	family	BetaBetaAlpha-zinc finger
9581	medline	19111667
9581	tax_group	fungi
9581	type	PBM, CSA and/or DIP-chip
9582	class	Zinc-coordinating
9582	family	BetaBetaAlpha-zinc finger
9582	medline	19111667
9582	tax_group	fungi
9582	type	PBM, CSA and/or DIP-chip
9583	class	Zinc-coordinating
9583	family	BetaBetaAlpha-zinc finger
9583	medline	19111667
9583	tax_group	fungi
9583	type	PBM, CSA and/or DIP-chip
9584	class	Zinc-coordinating
9584	family	BetaBetaAlpha-zinc finger
9584	medline	16522208
9584	tax_group	fungi
9584	type	ChIP-on-chip
9585	class	Zinc-coordinating
9585	family	BetaBetaAlpha-zinc finger
9585	medline	19111667
9585	tax_group	fungi
9585	type	PBM, CSA and/or DIP-chip
9586	class	Zinc-coordinating
9586	family	BetaBetaAlpha-zinc finger
9586	medline	19111667
9586	tax_group	fungi
9586	type	PBM, CSA and/or DIP-chip
9587	class	Ig-fold
9587	family	NDT80/PhoG
9587	medline	18842628
9587	tax_group	fungi
9587	type	PBM
9588	class	Other Alpha-Helix
9588	family	High Mobility Group box (HMG)
9588	medline	19111667
9588	tax_group	fungi
9588	type	PBM, CSA and/or DIP-chip
9589	class	Other Alpha-Helix
9589	family	High Mobility Group box (HMG)
9589	medline	18842628
9589	tax_group	fungi
9589	type	PBM
9590	class	Other Alpha-Helix
9590	family	High Mobility Group box (HMG)
9590	medline	18842628
9590	tax_group	fungi
9590	type	PBM
9591	class	Zinc-coordinating
9591	family	BetaBetaAlpha-zinc finger
9591	medline	18842628
9591	tax_group	fungi
9591	type	PBM
9592	class	Zinc-coordinating
9592	family	Fungal Zn cluster
9592	medline	19111667
9592	tax_group	fungi
9592	type	PBM, CSA and/or DIP-chip
9593	class	Zipper-Type
9593	family	Leucine Zipper
9593	medline	16522208
9593	tax_group	fungi
9593	type	ChIP-on-chip
9594	class	Helix-Turn-Helix
9594	family	Myb
9594	medline	18842628
9594	tax_group	fungi
9594	type	PBM
9595	class	Helix-Turn-Helix
9595	family	Myb
9595	medline	18842628
9595	tax_group	fungi
9595	type	PBM
9596	class	Zinc-coordinating
9596	family	Fungal Zn cluster
9596	medline	19111667
9596	tax_group	fungi
9596	type	PBM, CSA and/or DIP-chip
9597	class	Zinc-coordinating
9597	family	Fungal Zn cluster
9597	medline	16522208
9597	tax_group	fungi
9597	type	ChIP-on-chip
9598	class	Zinc-coordinating
9598	family	Fungal Zn cluster
9598	medline	19111667
9598	tax_group	fungi
9598	type	PBM, CSA and/or DIP-chip
9599	class	Other
9599	family	KilA-N
9599	medline	19111667
9599	tax_group	fungi
9599	type	PBM, CSA and/or DIP-chip
9600	class	Helix-Turn-Helix
9600	family	Homeo
9600	medline	19111667
9600	tax_group	fungi
9600	type	PBM, CSA and/or DIP-chip
9601	class	Zipper-Type
9601	family	Helix-Loop-Helix
9601	medline	18842628
9601	tax_group	fungi
9601	type	PBM
9602	class	Zinc-coordinating
9602	family	Fungal Zn cluster
9602	medline	19111667
9602	tax_group	fungi
9602	type	PBM, CSA and/or DIP-chip
9603	class	Helix-Turn-Helix
9603	family	Myb
9603	medline	19111667
9603	tax_group	fungi
9603	type	PBM, CSA and/or DIP-chip
9604	class	Zinc-coordinating
9604	family	Fungal Zn cluster
9604	medline	19111667
9604	tax_group	fungi
9604	type	PBM, CSA and/or DIP-chip
9605	class	Zinc-coordinating
9605	family	Fungal Zn cluster
9605	medline	19111667
9605	tax_group	fungi
9605	type	PBM, CSA and/or DIP-chip
9606	class	Zinc-coordinating
9606	family	Fungal Zn cluster
9606	medline	19111667
9606	tax_group	fungi
9606	type	PBM, CSA and/or DIP-chip
9607	class	Helix-Turn-Helix
9607	family	Myb
9607	medline	19111667
9607	tax_group	fungi
9607	type	PBM, CSA and/or DIP-chip
9608	class	Zinc-coordinating
9608	family	BetaBetaAlpha-zinc finger
9608	medline	19111667
9608	tax_group	fungi
9608	type	PBM, CSA and/or DIP-chip
9609	class	Winged Helix-Turn-Helix
9609	family	RFX
9609	medline	19111667
9609	tax_group	fungi
9609	type	PBM, CSA and/or DIP-chip
9610	class	Zinc-coordinating
9610	family	BetaBetaAlpha-zinc finger
9610	medline	19111667
9610	tax_group	fungi
9610	type	PBM, CSA and/or DIP-chip
9611	class	Zinc-coordinating
9611	family	Fungal Zn cluster
9611	medline	19111667
9611	tax_group	fungi
9611	type	PBM, CSA and/or DIP-chip
9612	class	Zinc-coordinating
9612	family	BetaBetaAlpha-zinc finger
9612	medline	19111667
9612	tax_group	fungi
9612	type	PBM, CSA and/or DIP-chip
9613	class	Other Alpha-Helix
9613	family	MADS
9613	medline	10487868
9613	tax_group	fungi
9613	type	COMPILED
9614	class	Zinc-coordinating
9614	family	BetaBetaAlpha-zinc finger
9614	medline	16522208
9614	tax_group	fungi
9614	type	ChIP-on-chip
9615	class	Other Alpha-Helix
9615	family	High Mobility Group box (HMG)
9615	medline	19111667
9615	tax_group	fungi
9615	type	PBM, CSA and/or DIP-chip
9616	class	Zinc-coordinating
9616	family	BetaBetaAlpha-zinc finger
9616	medline	19111667
9616	tax_group	fungi
9616	type	PBM, CSA and/or DIP-chip
9617	class	Zinc-coordinating
9617	family	BetaBetaAlpha-zinc finger
9617	medline	19111667
9617	tax_group	fungi
9617	type	PBM, CSA and/or DIP-chip
9618	class	Zinc-coordinating
9618	family	Fungal Zn cluster
9618	medline	19111667
9618	tax_group	fungi
9618	type	PBM, CSA and/or DIP-chip
9619	class	Zinc-coordinating
9619	family	Fungal Zn cluster
9619	medline	19111667
9619	tax_group	fungi
9619	type	PBM, CSA and/or DIP-chip
9620	class	Zipper-Type
9620	family	Helix-Loop-Helix
9620	medline	18842628
9620	tax_group	fungi
9620	type	PBM
9621	class	Winged Helix-Turn-Helix
9621	family	E2F
9621	medline	18842628
9621	tax_group	fungi
9621	type	PBM
9622	class	Zinc-coordinating
9622	family	BetaBetaAlpha-zinc finger
9622	medline	18842628
9622	tax_group	fungi
9622	type	PBM
9623	class	Zinc-coordinating
9623	family	BetaBetaAlpha-zinc finger
9623	medline	19111667
9623	tax_group	fungi
9623	type	PBM, CSA and/or DIP-chip
9624	class	Zinc-coordinating
9624	family	Fungal Zn cluster
9624	medline	19111667
9624	tax_group	fungi
9624	type	PBM, CSA and/or DIP-chip
9625	class	Winged Helix-Turn-Helix
9625	family	E2F
9625	medline	19111667
9625	tax_group	fungi
9625	type	PBM, CSA and/or DIP-chip
9626	class	Zipper-Type
9626	family	Leucine Zipper
9626	medline	17130146
9626	tax_group	fungi
9626	type	COMPILED
9627	class	Other Alpha-Helix
9627	family	MADS
9627	medline	18842628
9627	tax_group	fungi
9627	type	PBM
9628	class	Helix-Turn-Helix
9628	family	Myb
9628	medline	17130146
9628	tax_group	fungi
9628	type	COMPILED
9629	class	Other
9629	family	KilA-N
9629	medline	19111667
9629	tax_group	fungi
9629	type	PBM, CSA and/or DIP-chip
9630	class	Beta-sheet
9630	family	TATA-binding
9630	medline	18842628
9630	tax_group	fungi
9630	type	PBM
9631	class	Other Alpha-Helix
9631	family	High Mobility Group box (HMG)
9631	medline	16522208
9631	tax_group	fungi
9631	type	ChIP-on-chip
9632	class	Other
9632	family	Other
9632	medline	16522208
9632	tax_group	fungi
9632	type	ChIP-on-chip
9633	class	Zinc-coordinating
9633	family	GATA
9633	medline	19111667
9633	tax_group	fungi
9633	type	PBM, CSA and/or DIP-chip
9634	class	Other
9634	family	Other
9634	medline	18842628
9634	tax_group	fungi
9634	type	PBM
9635	class	Zinc-coordinating
9635	family	Fungal Zn cluster
9635	medline	19111667
9635	tax_group	fungi
9635	type	PBM, CSA and/or DIP-chip
9636	class	Zinc-coordinating
9636	family	Fungal Zn cluster
9636	medline	19111667
9636	tax_group	fungi
9636	type	PBM, CSA and/or DIP-chip
9637	class	Helix-Turn-Helix
9637	family	Homeo
9637	medline	17130146
9637	tax_group	fungi
9637	type	COMPILED
9638	class	Zinc-coordinating
9638	family	BetaBetaAlpha-zinc finger
9638	medline	16522208
9638	tax_group	fungi
9638	type	ChIP-on-chip
9639	class	Zinc-coordinating
9639	family	BetaBetaAlpha-zinc finger
9639	medline	18842628
9639	tax_group	fungi
9639	type	PBM
9640	class	Zinc-coordinating
9640	family	BetaBetaAlpha-zinc finger
9640	medline	19111667
9640	tax_group	fungi
9640	type	PBM, CSA and/or DIP-chip
9641	class	Zinc-coordinating
9641	family	BetaBetaAlpha-zinc finger
9641	medline	19111667
9641	tax_group	fungi
9641	type	PBM, CSA and/or DIP-chip
9642	class	Other
9642	family	AT-hook
9642	medline	19111667
9642	tax_group	fungi
9642	type	PBM, CSA and/or DIP-chip
9643	class	Zinc-coordinating
9643	family	Fungal Zn cluster
9643	medline	16522208
9643	tax_group	fungi
9643	type	ChIP-on-chip
9644	class	Zinc-coordinating
9644	family	Fungal Zn cluster
9644	medline	18842628
9644	tax_group	fungi
9644	type	PBM
9645	class	Ig-fold
9645	family	Rel
9645	medline	19111667
9645	tax_group	fungi
9645	type	PBM, CSA and/or DIP-chip
9646	class	Zinc-coordinating
9646	family	BetaBetaAlpha-zinc finger
9646	medline	19111667
9646	tax_group	fungi
9646	type	PBM, CSA and/or DIP-chip
9647	class	Helix-Turn-Helix
9647	family	Myb
9647	medline	19111667
9647	tax_group	fungi
9647	type	PBM, CSA and/or DIP-chip
9648	class	Zinc-coordinating
9648	family	Fungal Zn cluster
9648	medline	19111667
9648	tax_group	fungi
9648	type	PBM, CSA and/or DIP-chip
9649	class	Zinc-coordinating
9649	family	Fungal Zn cluster
9649	medline	19111667
9649	tax_group	fungi
9649	type	PBM, CSA and/or DIP-chip
9650	class	Helix-Turn-Helix
9650	family	Homeo
9650	medline	19111667
9650	tax_group	fungi
9650	type	PBM, CSA and/or DIP-chip
9651	class	Zinc-coordinating
9651	family	Fungal Zn cluster
9651	medline	17130146
9651	tax_group	fungi
9651	type	COMPILED
9652	class	Helix-Turn-Helix
9652	family	Homeo
9652	medline	19111667
9652	tax_group	fungi
9652	type	PBM, CSA and/or DIP-chip
9653	class	Zipper-Type
9653	family	Helix-Loop-Helix
9653	medline	19111667
9653	tax_group	fungi
9653	type	PBM, CSA and/or DIP-chip
9654	class	Zinc-coordinating
9654	family	Fungal Zn cluster
9654	medline	19111667
9654	tax_group	fungi
9654	type	PBM, CSA and/or DIP-chip
9655	class	Zinc-coordinating
9655	family	Fungal Zn cluster
9655	medline	19111667
9655	tax_group	fungi
9655	type	PBM, CSA and/or DIP-chip
9656	class	Zinc-coordinating
9656	family	Fungal Zn cluster
9656	medline	17130146
9656	tax_group	fungi
9656	type	COMPILED
9657	class	Zinc-coordinating
9657	family	BetaBetaAlpha-zinc finger
9657	medline	18842628
9657	tax_group	fungi
9657	type	PBM
9658	class	Ig-fold
9658	family	Rel
9658	medline	19111667
9658	tax_group	fungi
9658	type	PBM, CSA and/or DIP-chip
9659	class	Zipper-Type
9659	family	Leucine Zipper
9659	medline	18842628
9659	tax_group	fungi
9659	type	PBM
9660	class	Zipper-Type
9660	family	Leucine Zipper
9660	medline	19111667
9660	tax_group	fungi
9660	type	PBM, CSA and/or DIP-chip
9661	class	Zipper-Type
9661	family	Leucine Zipper
9661	medline	16522208
9661	tax_group	fungi
9661	type	ChIP-on-chip
9662	class	Zipper-Type
9662	family	Leucine Zipper
9662	medline	18842628
9662	tax_group	fungi
9662	type	PBM
9663	class	Zipper-Type
9663	family	Leucine Zipper
9663	medline	17130146
9663	tax_group	fungi
9663	type	COMPILED
9664	class	Zinc-coordinating
9664	family	Fungal Zn cluster
9664	medline	19111667
9664	tax_group	fungi
9664	type	PBM, CSA and/or DIP-chip
9665	class	Helix-Turn-Helix
9665	family	Myb
9665	medline	17130146
9665	tax_group	fungi
9665	type	COMPILED
9666	class	Zinc-coordinating
9666	family	Fungal Zn cluster
9666	medline	19111667
9666	tax_group	fungi
9666	type	PBM, CSA and/or DIP-chip
9667	class	Zinc-coordinating
9667	family	BetaBetaAlpha-zinc finger
9667	medline	19111667
9667	tax_group	fungi
9667	type	PBM, CSA and/or DIP-chip
9668	class	Zinc-coordinating
9668	family	Fungal Zn cluster
9668	medline	19111667
9668	tax_group	fungi
9668	type	PBM, CSA and/or DIP-chip
9669	class	Zinc-coordinating
9669	family	BetaBetaAlpha-zinc finger
9669	medline	19111667
9669	tax_group	fungi
9669	type	PBM, CSA and/or DIP-chip
9670	class	Helix-Turn-Helix
9670	family	Homeo
9670	medline	16522208
9670	tax_group	fungi
9670	type	ChIP-on-chip
9671	class	Zinc-coordinating
9671	family	Fungal Zn cluster
9671	medline	19111667
9671	tax_group	fungi
9671	type	PBM, CSA and/or DIP-chip
9672	class	Zinc-coordinating
9672	family	Fungal Zn cluster
9672	medline	19111667
9672	tax_group	fungi
9672	type	PBM, CSA and/or DIP-chip
9673	class	Zinc-coordinating
9673	family	Fungal Zn cluster
9673	medline	19111667
9673	tax_group	fungi
9673	type	PBM, CSA and/or DIP-chip
9674	class	Zinc-coordinating
9674	family	Fungal Zn cluster
9674	medline	19111667
9674	tax_group	fungi
9674	type	PBM, CSA and/or DIP-chip
9675	class	Zinc-coordinating
9675	family	BetaBetaAlpha-zinc finger
9675	medline	19111667
9675	tax_group	fungi
9675	type	PBM, CSA and/or DIP-chip
9676	class	Zinc-coordinating
9676	family	Fungal Zn cluster
9676	medline	19111667
9676	tax_group	fungi
9676	type	PBM, CSA and/or DIP-chip
9677	class	Helix-Turn-Helix
9677	family	Homeo
9677	medline	19111667
9677	tax_group	fungi
9677	type	PBM, CSA and/or DIP-chip
9678	class	Zinc-coordinating
9678	family	BetaBetaAlpha-zinc finger
9678	medline	19111667
9678	tax_group	fungi
9678	type	PBM, CSA and/or DIP-chip
9679	class	Zinc-coordinating
9679	family	BetaBetaAlpha-zinc finger
9679	medline	18842628
9679	tax_group	fungi
9679	type	PBM
9680	class	Zinc-coordinating
9680	family	BetaBetaAlpha-zinc finger
9680	medline	19111667
9680	tax_group	fungi
9680	type	PBM, CSA and/or DIP-chip
9681	class	Zinc-coordinating
9681	family	Fungal Zn cluster
9681	medline	19111667
9681	tax_group	fungi
9681	type	PBM, CSA and/or DIP-chip
9682	class	Zinc-coordinating
9682	family	Fungal Zn cluster
9682	medline	19111667
9682	tax_group	fungi
9682	type	PBM, CSA and/or DIP-chip
9683	class	Zinc-coordinating
9683	family	Fungal Zn cluster
9683	medline	19111667
9683	tax_group	fungi
9683	type	PBM, CSA and/or DIP-chip
9684	class	Zinc-coordinating
9684	family	BetaBetaAlpha-zinc finger
9684	medline	16522208
9684	tax_group	fungi
9684	type	ChIP-on-chip
9685	class	Zinc-coordinating
9685	family	BetaBetaAlpha-zinc finger
9685	medline	19111667
9685	tax_group	fungi
9685	type	PBM, CSA and/or DIP-chip
9686	class	Unknown
9686	comment	-
9686	consensus	YKGTTKCCATGGMAACMR
9686	medline	17442748
9687	class	Unknown
9687	comment	-
9687	consensus	YNRCCACYAGATGGCAGYM
9687	medline	17442748
9688	class	Unknown
9688	comment	-
9688	consensus	KGTTGCTWRGCAACM
9688	medline	17442748
9689	class	Unknown
9689	comment	-
9689	consensus	RGCMTKCTGGGARTTGTAGTYY
9689	medline	17442748
9690	class	Unknown
9690	comment	-
9690	consensus	TCCCATTARYRTTAATGGGA
9690	medline	17442748
9691	class	Unknown
9691	comment	-
9691	consensus	CAAAGGCTCTTTTMAGAGCCACY
9691	medline	17442748
9692	class	Unknown
9692	comment	-
9692	consensus	NNNCCAGCAGATGGCGCTRT
9692	medline	17442748
9693	class	Unknown
9693	comment	-
9693	consensus	MATGAATWATTCATR
9693	medline	17442748
9694	class	Unknown
9694	comment	-
9694	consensus	TTCAGCACCWYGGACAGMKMC
9694	medline	17442748
9695	class	Unknown
9695	comment	-
9695	consensus	YKGTTTCCATGGAAACMR
9695	medline	17442748
9696	class	Unknown
9696	comment	-
9696	consensus	ATGGAAATGCTGACAGAMCCTTAA
9696	medline	17442748
9697	class	Unknown
9697	comment	-
9697	consensus	RTGGCCTGAAAGAGTTAATGCW
9697	medline	17442748
9698	class	Unknown
9698	comment	-
9698	consensus	WTGCTAATTAGCA
9698	medline	17442748
9699	class	Unknown
9699	comment	-
9699	consensus	WNATCCAGATGTTTGGCAYYW
9699	medline	17442748
9700	class	Unknown
9700	comment	-
9700	consensus	MATTTGCATGCAAATGA
9700	medline	17442748
9701	class	Unknown
9701	comment	-
9701	consensus	CTTTGARATCCTYAGATGAAAGR
9701	medline	17442748
9702	class	Unknown
9702	comment	-
9702	consensus	WNWRCATCTGRTTTGCATTW
9702	medline	17442748
9703	class	Unknown
9703	comment	-
9703	consensus	ATTTGCATNTSATTTGCAT
9703	medline	17442748
9704	class	Unknown
9704	comment	-
9704	consensus	TGCTAATTAGCAGCH
9704	medline	17442748
9705	class	Unknown
9705	comment	-
9705	consensus	TGACAGCTGTCA
9705	medline	17442748
9706	class	Unknown
9706	comment	-
9706	consensus	ATTTGCATNTCATTTGCATW
9706	medline	17442748
9707	class	Unknown
9707	comment	-
9707	consensus	CAGCTGTTWAACAGCTG
9707	medline	17442748
9708	class	Unknown
9708	comment	-
9708	consensus	TKACCACCAGGTGGYGCTRW
9708	medline	17442748
9709	class	Unknown
9709	comment	-
9709	consensus	DGARAACAGATGGCW
9709	medline	17442748
9710	class	Unknown
9710	comment	-
9710	consensus	AAARGMAATTKCYTTT
9710	medline	17442748
9711	class	Unknown
9711	comment	-
9711	consensus	WAAACACAGCTGT
9711	medline	17442748
9712	class	Unknown
9712	comment	-
9712	consensus	ATTTGCATSTCATTWGCA
9712	medline	17442748
9713	class	Unknown
9713	comment	-
9713	consensus	AGAACATCTGTTTCY
9713	medline	17442748
9714	class	Unknown
9714	comment	-
9714	consensus	WGCTAATTGCAAATG
9714	medline	17442748
9715	class	Unknown
9715	comment	-
9715	consensus	CTTTGAAATGTCAAW
9715	medline	17442748
9716	class	Unknown
9716	comment	-
9716	consensus	CTTTTCATCTTCAAAGYRCTTT
9716	medline	17442748
9717	class	Unknown
9717	comment	-
9717	consensus	CTGACATTTYCAAA
9717	medline	17442748
9718	class	Unknown
9718	comment	-
9718	consensus	GWAATTGGAAACAKCTG
9718	medline	17442748
9719	class	Unknown
9719	comment	-
9719	consensus	WSATTTGCATTGCAAATGM
9719	medline	17442748
9720	class	Unknown
9720	comment	-
9720	consensus	WRACTTCAAAGGGAGCTB
9720	medline	17442748
9721	class	Unknown
9721	comment	-
9721	consensus	KGAAAWKNNAWTTYCHW
9721	medline	17442748
9722	class	Unknown
9722	comment	-
9722	consensus	YATGCAAATGAGCCM
9722	medline	17442748
9723	class	Unknown
9723	comment	-
9723	consensus	GCAAATTAGCAGCT
9723	medline	17442748
9724	class	Unknown
9724	comment	-
9724	consensus	KNKGTYTCCTAGGAAACM
9724	medline	17442748
9725	class	Unknown
9725	comment	-
9725	consensus	TCCCATTGACTTCAAWGGGAGYT
9725	medline	17442748
9726	class	Unknown
9726	comment	-
9726	consensus	CTTTGAAATGCTAATK
9726	medline	17442748
9727	class	Unknown
9727	comment	-
9727	consensus	AAGCCTAATTAGCA
9727	medline	17442748
9728	class	Unknown
9728	comment	-
9728	consensus	TTGKCAGRAAATGAWW
9728	medline	17442748
9729	class	Unknown
9729	comment	-
9729	consensus	GTGTAATTGGAAACAGCTG
9729	medline	17442748
9730	class	Unknown
9730	comment	-
9730	consensus	GCTAATTGGATTTG
9730	medline	17442748
9731	class	Unknown
9731	comment	-
9731	consensus	ARCAGCTGTTSAAA
9731	medline	17442748
9732	class	Unknown
9732	comment	-
9732	consensus	AGAGTGCCACCTACTGAAT
9732	medline	17442748
9733	class	Unknown
9733	comment	-
9733	consensus	YTAATGAGCTCATTAR
9733	medline	17442748
9734	class	Unknown
9734	comment	-
9734	consensus	KGTAATTAGCAGCTG
9734	medline	17442748
9735	class	Unknown
9735	comment	-
9735	consensus	TGGGTAATTACATTCTGYY
9735	medline	17442748
9736	class	Unknown
9736	comment	-
9736	consensus	CATTTGCATATGCAAAT
9736	medline	17442748
9737	class	Unknown
9737	comment	-
9737	consensus	RYVTAATTAGGAAGGTAAATM
9737	medline	17442748
9738	class	Unknown
9738	comment	-
9738	consensus	TCATTTGCATTKCAAAT
9738	medline	17442748
9739	class	Unknown
9739	comment	-
9739	consensus	YMATTCATCACTGTCAR
9739	medline	17442748
9740	class	Unknown
9740	comment	-
9740	consensus	WGCTAATTAGCACTT
9740	medline	17442748
9741	class	Unknown
9741	comment	-
9741	consensus	CTCATTAATCAAAG
9741	medline	17442748
9742	class	Unknown
9742	comment	-
9742	consensus	TGACAGTAATTAGM
9742	medline	17442748
9743	class	Unknown
9743	comment	-
9743	consensus	CATAAATCACAGCTKH
9743	medline	17442748
9744	class	Unknown
9744	comment	-
9744	consensus	TGWCATTTTGACAG
9744	medline	17442748
9745	class	Unknown
9745	comment	-
9745	consensus	YWYATGAATATTCATRWR
9745	medline	17442748
9746	class	Unknown
9746	comment	-
9746	consensus	TGTCAGCATTTCCATTATRA
9746	medline	17442748
9747	class	Unknown
9747	comment	-
9747	consensus	AATTGCTTCCAGATG
9747	medline	17442748
9748	class	Unknown
9748	comment	-
9748	consensus	TGATTTATGAGGTG
9748	medline	17442748
9749	class	Unknown
9749	comment	-
9749	consensus	TGACAGCTGTTT
9749	medline	17442748
9750	class	Unknown
9750	comment	-
9750	consensus	KCTCATTTGCATTTCAAARR
9750	medline	17442748
9751	class	Unknown
9751	comment	-
9751	consensus	GAATGATTAATGACY
9751	medline	17442748
9752	class	Unknown
9752	comment	-
9752	consensus	WKVAAATGCAATTAAG
9752	medline	17442748
9753	class	Unknown
9753	comment	-
9753	consensus	WTCATCCAGATGTTTGGY
9753	medline	17442748
9754	class	Unknown
9754	comment	-
9754	consensus	WGCTAATTRRMTKYYWAWTANM
9754	medline	17442748
9755	class	Unknown
9755	comment	-
9755	consensus	CTGAACAGATGGCC
9755	medline	17442748
9756	class	Unknown
9756	comment	-
9756	consensus	TGATTAATTGCAAA
9756	medline	17442748
9757	class	Unknown
9757	comment	-
9757	consensus	NATGCYTCATTAAMY
9757	medline	17442748
9758	class	Unknown
9758	comment	-
9758	consensus	ATGGAAACAGATGGT
9758	medline	17442748
9759	class	Unknown
9759	comment	-
9759	consensus	AWGCCTTTGAAGTTMW
9759	medline	17442748
9760	class	Unknown
9760	comment	-
9760	consensus	CAATTTGCAATTCADW
9760	medline	17442748
9761	class	Unknown
9761	comment	-
9761	consensus	CCAATTTGCATTTCATTTGC
9761	medline	17442748
9762	class	Unknown
9762	comment	-
9762	consensus	YRGATAATTGAGAGTTGACTR
9762	medline	17442748
9763	class	Unknown
9763	comment	-
9763	consensus	WTTSCAGGAAATTGCW
9763	medline	17442748
9764	class	Unknown
9764	comment	-
9764	consensus	TKCWAATGCAAATCAGNY
9764	medline	17442748
9765	class	Unknown
9765	comment	-
9765	consensus	AGCAATTAACCTTY
9765	medline	17442748
9766	class	Unknown
9766	comment	-
9766	consensus	GGTAATTACATTCTGCYT
9766	medline	17442748
9767	class	Unknown
9767	comment	-
9767	consensus	ACTTGACATTTGCA
9767	medline	17442748
9768	class	Unknown
9768	comment	-
9768	consensus	CTGTCAAAATCAAT
9768	medline	17442748
9769	class	Unknown
9769	comment	-
9769	consensus	GACATCTGGTKGCAATTTG
9769	medline	17442748
9770	class	Unknown
9770	comment	-
9770	consensus	WKSTTTTCATTAAAGM
9770	medline	17442748
9771	class	Unknown
9771	comment	-
9771	consensus	MAKCTGMYTTTGATY
9771	medline	17442748
9772	class	Unknown
9772	comment	-
9772	consensus	RNNWWTTGAAGCAATTAGCW
9772	medline	17442748
9773	class	Unknown
9773	comment	-
9773	consensus	WRGTTAATTGGAATCANW
9773	medline	17442748
9774	class	Unknown
9774	comment	-
9774	consensus	GTAATTGATTCCAGATG
9774	medline	17442748
9775	class	Unknown
9775	comment	-
9775	consensus	CTGGCAGCCTGCCAG
9775	medline	17442748
9776	class	Unknown
9776	comment	-
9776	consensus	CARCTGTGWAATTG
9776	medline	17442748
9777	class	Unknown
9777	comment	-
9777	consensus	CTAATTTGATTTGGCAGA
9777	medline	17442748
9778	class	Unknown
9778	comment	-
9778	consensus	YAAAGTGCTTTGAGCTCCTTGGA
9778	medline	17442748
9779	class	Unknown
9779	comment	-
9779	consensus	WRGMAAATTSAATTTKCMWWW
9779	medline	17442748
9780	class	Unknown
9780	comment	-
9780	consensus	YTGCTCTSTAATTAG
9780	medline	17442748
9781	class	Unknown
9781	comment	-
9781	consensus	WNNNNNWWMWTWRMWKYWAWKTAR
9781	medline	17442748
9782	class	Unknown
9782	comment	-
9782	consensus	CATWAAGCTGTCAG
9782	medline	17442748
9783	class	Unknown
9783	comment	-
9783	consensus	GATTTGCATTTCATTTGCAY
9783	medline	17442748
9784	class	Unknown
9784	comment	-
9784	consensus	DSAGGAAATGACTCA
9784	medline	17442748
9785	class	Unknown
9785	comment	-
9785	consensus	ACTGAGCATGCTCAG
9785	medline	17442748
9786	class	Unknown
9786	comment	-
9786	consensus	ATTTGCATACATTTGCAT
9786	medline	17442748
9787	class	Unknown
9787	comment	-
9787	consensus	TCAAAGYACTTTWCAARM
9787	medline	17442748
9788	class	Unknown
9788	comment	-
9788	consensus	AAATGTCACCATCTGKW
9788	medline	17442748
9789	class	Unknown
9789	comment	-
9789	consensus	TTGACCTTTAAAGCW
9789	medline	17442748
9790	class	Unknown
9790	comment	-
9790	consensus	CTCCCATTGACTTCAATGG
9790	medline	17442748
9791	class	Unknown
9791	comment	-
9791	consensus	TGCTGASTCAGCA
9791	medline	17442748
9792	class	Unknown
9792	comment	-
9792	consensus	WKMAATTAGCCATCTG
9792	medline	17442748
9793	class	Unknown
9793	comment	-
9793	consensus	YSAATTATCCAGATAATTGCY
9793	medline	17442748
9794	class	Unknown
9794	comment	-
9794	consensus	WKCTGTSAWTCAMAR
9794	medline	17442748
9795	class	Unknown
9795	comment	-
9795	consensus	ATTTCCTGGGGATTAATGACY
9795	medline	17442748
9796	class	Unknown
9796	comment	-
9796	consensus	CTGACCTACTTT
9796	medline	17442748
9797	class	Unknown
9797	comment	-
9797	consensus	CTCATTTGCATATTC
9797	medline	17442748
9798	class	Unknown
9798	comment	-
9798	consensus	WYTGTTTTKCTTGGCA
9798	medline	17442748
9799	class	Unknown
9799	comment	-
9799	consensus	TTTCCAATTAAGCT
9799	medline	17442748
9800	class	Unknown
9800	comment	-
9800	consensus	CAAGATTAATKGCT
9800	medline	17442748
9801	class	Unknown
9801	comment	-
9801	consensus	WWNAAGHTGAAAATTGCT
9801	medline	17442748
9802	class	Unknown
9802	comment	-
9802	consensus	GATAATTGAGAGTTGAC
9802	medline	17442748
9803	class	Unknown
9803	comment	-
9803	consensus	WSATTTWCWGKAAATSW
9803	medline	17442748
9804	class	Unknown
9804	comment	-
9804	consensus	AAACCAATTAGCATC
9804	medline	17442748
9805	class	Unknown
9805	comment	-
9805	consensus	CTTAATTACAGGCW
9805	medline	17442748
9806	class	Unknown
9806	comment	-
9806	consensus	AGCTGCAAATTGCATTC
9806	medline	17442748
9807	class	Unknown
9807	comment	-
9807	consensus	GMAGCTTTTAATGA
9807	medline	17442748
9808	class	Unknown
9808	comment	-
9808	consensus	WGCTGTCAKTTKTMATK
9808	medline	17442748
9809	class	Unknown
9809	comment	-
9809	consensus	YTGCCAAATGGAAAW
9809	medline	17442748
9810	class	Unknown
9810	comment	-
9810	consensus	GCTAATTRCAAATSA
9810	medline	17442748
9811	class	Unknown
9811	comment	-
9811	consensus	YTGCTCTAATTGCA
9811	medline	17442748
9812	class	Unknown
9812	comment	-
9812	consensus	TTTTGACAGCTCAG
9812	medline	17442748
9813	class	Unknown
9813	comment	-
9813	consensus	TGCCAAGTTTCAGCCTGGAG
9813	medline	17442748
9814	class	Unknown
9814	comment	-
9814	consensus	WGMCAGATGRTMTKKNW
9814	medline	17442748
9815	class	Unknown
9815	comment	-
9815	consensus	TCTGATTGGCTGKCR
9815	medline	17442748
9816	class	Unknown
9816	comment	-
9816	consensus	TCCAAYTTGGATAATTGCAT
9816	medline	17442748
9817	class	Unknown
9817	comment	-
9817	consensus	TRGTTCTCATTAAG
9817	medline	17442748
9818	class	Unknown
9818	comment	-
9818	consensus	ACAGCCATAAATCAC
9818	medline	17442748
9819	class	Unknown
9819	comment	-
9819	consensus	CTTAATTAGCTGWA
9819	medline	17442748
9820	class	Unknown
9820	comment	-
9820	consensus	ACCCTRGTGGCCTGAAAGAG
9820	medline	17442748
9821	class	Unknown
9821	comment	-
9821	consensus	NKYTGCCAAGAGCAACA
9821	medline	17442748
9822	class	Unknown
9822	comment	-
9822	consensus	WNRRAGBAATTTGGCAGCW
9822	medline	17442748
9823	class	Unknown
9823	comment	-
9823	consensus	ACAAAAGCCAGGAAAT
9823	medline	17442748
9824	class	Unknown
9824	comment	-
9824	consensus	ACTGACCTACTTTCC
9824	medline	17442748
9825	class	Unknown
9825	comment	-
9825	consensus	GTGACCTTTTGTTC
9825	medline	17442748
9826	class	Unknown
9826	comment	-
9826	consensus	WGCCAAAMCAAACAGN
9826	medline	17442748
9827	class	Unknown
9827	comment	-
9827	consensus	WNNWNACAGATCATTAACT
9827	medline	17442748
9828	class	Unknown
9828	comment	-
9828	consensus	CATTAATCAGMATT
9828	medline	17442748
9829	class	Unknown
9829	comment	-
9829	consensus	TGCTAATGAGGCCAAGGT
9829	medline	17442748
9830	class	Unknown
9830	comment	-
9830	consensus	MTWCTCAGATGAAAGRTGCTW
9830	medline	17442748
9831	class	Unknown
9831	comment	-
9831	consensus	CCTYTGCTGCCCTCTWVTG
9831	medline	17442748
9832	class	Unknown
9832	comment	-
9832	consensus	MAGAAATCCATTAACW
9832	medline	17442748
9833	class	Unknown
9833	comment	-
9833	consensus	CAGATTGACATTTC
9833	medline	17442748
9834	class	Unknown
9834	comment	-
9834	consensus	TTGCTTTCAAATGCCAGGA
9834	medline	17442748
9835	class	Unknown
9835	comment	-
9835	consensus	CATTAACCTTTAAC
9835	medline	17442748
9836	class	Unknown
9836	comment	-
9836	consensus	MCCTGAAGCATGARATTTGATTR
9836	medline	17442748
9837	class	Unknown
9837	comment	-
9837	consensus	WRRKAARYSAYTTMTCT
9837	medline	17442748
9838	class	Unknown
9838	comment	-
9838	consensus	NCTGTGATTAAAGCA
9838	medline	17442748
9839	class	Unknown
9839	comment	-
9839	consensus	CAKCTGGATGAAAAATG
9839	medline	17442748
9840	class	Unknown
9840	comment	-
9840	consensus	CACTAGGGKACCATTTAGT
9840	medline	17442748
9841	class	Unknown
9841	comment	-
9841	consensus	SCTTTGTAAACAAG
9841	medline	17442748
9842	class	Unknown
9842	comment	-
9842	consensus	TGCCTAATTACACA
9842	medline	17442748
9843	class	Unknown
9843	comment	-
9843	consensus	AWGGAAAWCWGWTTTCCWW
9843	medline	17442748
9844	class	Unknown
9844	comment	-
9844	consensus	TTGCTTTGGAAGCAGCT
9844	medline	17442748
9845	class	Unknown
9845	comment	-
9845	consensus	RCTTTCAGAAATSMMWWWW
9845	medline	17442748
9846	class	Unknown
9846	comment	-
9846	consensus	CTAATGATTTCCTG
9846	medline	17442748
9847	class	Unknown
9847	comment	-
9847	consensus	YCATTAGGAAGACAAATGR
9847	medline	17442748
9848	class	Unknown
9848	comment	-
9848	consensus	TCATTTCCTCCTAATTGNY
9848	medline	17442748
9849	class	Unknown
9849	comment	-
9849	consensus	TTGAAATGAAATGTGAC
9849	medline	17442748
9850	class	Unknown
9850	comment	-
9850	consensus	GATTTCCTGTTGTG
9850	medline	17442748
9851	class	Unknown
9851	comment	-
9851	consensus	CATGCTGAGATCAA
9851	medline	17442748
9852	class	Unknown
9852	comment	-
9852	consensus	WYTTGACCTTTTCA
9852	medline	17442748
9853	class	Unknown
9853	comment	-
9853	consensus	GCTTGTCAGAAACA
9853	medline	17442748
9854	class	Unknown
9854	comment	-
9854	consensus	TTCCCAGCTGTTGC
9854	medline	17442748
9855	class	Unknown
9855	comment	-
9855	consensus	WNNCTTGTAAWTMAGAR
9855	medline	17442748
9856	class	Unknown
9856	comment	-
9856	consensus	RTGTTAATGACTTC
9856	medline	17442748
9857	class	Unknown
9857	comment	-
9857	consensus	AAATGAAATTCATTTG
9857	medline	17442748
9858	class	Unknown
9858	comment	-
9858	consensus	ACTGATTTTCCTGACAA
9858	medline	17442748
9859	class	Unknown
9859	comment	-
9859	consensus	AGCTGCCAAAAATC
9859	medline	17442748
9860	class	Unknown
9860	comment	-
9860	consensus	CTGTTGACAGTAAA
9860	medline	17442748
9861	class	Unknown
9861	comment	-
9861	consensus	GAGCCAGCTGGCTCM
9861	medline	17442748
9862	class	Unknown
9862	comment	-
9862	consensus	CTTTGGCTTCAGACCAAAT
9862	medline	17442748
9863	class	Unknown
9863	comment	-
9863	consensus	NNMWTTCATTTTCCAAAGCA
9863	medline	17442748
9864	class	Unknown
9864	comment	-
9864	consensus	MTKNYWRATKMATYWRKMAR
9864	medline	17442748
9865	class	Unknown
9865	comment	-
9865	consensus	KWTTTCATTTGAATGCT
9865	medline	17442748
9866	class	Unknown
9866	comment	-
9866	consensus	WTTTGGCTTTAATGA
9866	medline	17442748
9867	class	Unknown
9867	comment	-
9867	consensus	TCATTTTGCAAGTGCAA
9867	medline	17442748
9868	class	Unknown
9868	comment	-
9868	consensus	AGCTGTCATTCTTGGAA
9868	medline	17442748
9869	class	Unknown
9869	comment	-
9869	consensus	CTGCCCTTGATTTG
9869	medline	17442748
9870	class	Unknown
9870	comment	-
9870	consensus	GCTTTGCTTCATTTCAG
9870	medline	17442748
9871	class	Unknown
9871	comment	-
9871	consensus	GGCAGTAATTTTCC
9871	medline	17442748
9872	class	Unknown
9872	comment	-
9872	consensus	CTTTGATCTTTCATT
9872	medline	17442748
9873	class	Unknown
9873	comment	-
9873	consensus	TCTGACAGAAATGTCAA
9873	medline	17442748
9874	class	Unknown
9874	comment	-
9874	consensus	TGYTCATTTGAAAGGWAATR
9874	medline	17442748
9875	class	Unknown
9875	comment	-
9875	consensus	TTAATGGCCCATGAAATGA
9875	medline	17442748
9876	class	Unknown
9876	comment	-
9876	consensus	ATCCATTTGTTGCCATGGT
9876	medline	17442748
9877	class	Unknown
9877	comment	-
9877	consensus	WTKWMMTTTKVAAAKKWMAW
9877	medline	17442748
9878	class	Unknown
9878	comment	-
9878	consensus	GTTCTCTGAAATGAAGT
9878	medline	17442748
9879	class	Unknown
9879	comment	-
9879	consensus	AGAGGGCAGCARAGYCCCA
9879	medline	17442748
9880	class	Unknown
9880	comment	-
9880	consensus	TTTCCTTTCCAGCTG
9880	medline	17442748
9881	class	Unknown
9881	comment	-
9881	consensus	ATTCATTTTGGCTTTGAAAG
9881	medline	17442748
9882	class	Unknown
9882	comment	-
9882	consensus	AAAGATGCARTATCCCTTTT
9882	medline	17442748
9883	class	Unknown
9883	comment	-
9883	consensus	MTGAACTTTGTTTGAACT
9883	medline	17442748
9884	class	Unknown
9884	comment	-
9884	consensus	GCTCTGGAAATTTCCAG
9884	medline	17442748
9885	class	Unknown
9885	comment	-
9885	consensus	KNNNTTTAATGGGAAATYTGMWWWK
9885	medline	17442748
9886	class	Unknown
9886	comment	-
9886	consensus	CTTTCAAAGGCTCATTA
9886	medline	17442748
9887	class	Unknown
9887	comment	-
9887	consensus	CTTGCCAAATGTGAATT
9887	medline	17442748
9888	class	Unknown
9888	comment	-
9888	consensus	TGACTGTGAAATTACAG
9888	medline	17442748
9889	class	Unknown
9889	comment	-
9889	consensus	CTYAAATCCTTTYTGGAA
9889	medline	17442748
9890	class	Unknown
9890	comment	-
9890	consensus	TTTCAAGTCAAAACA
9890	medline	17442748
9891	class	Unknown
9891	comment	-
9891	consensus	GAAAACAGTTTGTTCTCT
9891	medline	17442748
9892	class	Unknown
9892	comment	-
9892	consensus	WKRMYTTTKGCMAAAAKYMA
9892	medline	17442748
9893	class	Unknown
9893	comment	-
9893	consensus	TGTGAAATGAGTTGG
9893	medline	17442748
9894	class	Unknown
9894	comment	-
9894	consensus	CATTTCCTTTGTGGAATGAG
9894	medline	17442748
9895	class	Unknown
9895	comment	-
9895	consensus	TCATYTTGCTTCTGAAAATG
9895	medline	17442748
9896	class	Unknown
9896	comment	-
9896	consensus	TGACCTAGAGGTGAAAGGC
9896	medline	17442748
9897	class	Unknown
9897	comment	-
9897	consensus	ATGGCTTTCCAAATG
9897	medline	17442748
9898	class	Unknown
9898	comment	-
9898	consensus	CTTTGAGTTCCTTGGAAGAA
9898	medline	17442748
9899	class	Unknown
9899	comment	-
9899	consensus	TCTGGAAAAGCACATTTGAT
9899	medline	17442748
9900	class	Unknown
9900	comment	-
9900	consensus	CATTTCTCAGAAATGACT
9900	medline	17442748
9901	class	Unknown
9901	comment	-
9901	consensus	TTTCTCTTTGAAACCTGCAA
9901	medline	17442748
9902	class	Unknown
9902	comment	-
9902	consensus	TTTCATTAGAAGATGAAGCA
9902	medline	17442748
9903	class	Unknown
9903	comment	-
9903	consensus	GAAAATGGGCTGTTT
9903	medline	17442748
9904	class	Unknown
9904	comment	-
9904	consensus	TGYKTTGYYWWRGCAAMRCA
9904	medline	17442748
9905	class	Unknown
9905	comment	-
9905	consensus	ATGGCACTTTGGAAAATGGA
9905	medline	17442748
9906	class	Unknown
9906	comment	-
9906	consensus	TGGCTGKCTTCCCAG
9906	medline	17442748
9907	class	Unknown
9907	comment	-
9907	consensus	TTGGAAAGACTTCAAAGA
9907	medline	17442748
9908	class	Unknown
9908	comment	-
9908	consensus	AGMAGTAATTTACTAAATTG
9908	medline	17442748
9909	class	Unknown
9909	comment	-
9909	consensus	AATCATGTTTGAAAG
9909	medline	17442748
9910	class	Unknown
9910	comment	-
9910	consensus	CTGTGGAAAATCTGA
9910	medline	17442748
9911	class	Unknown
9911	comment	-
9911	consensus	AAAGCTTTCTTAATG
9911	medline	17442748
9912	class	Unknown
9912	comment	-
9912	consensus	GAATTTAGTGCTTGTGAAAA
9912	medline	17442748
9913	class	Unknown
9913	comment	-
9913	consensus	TGTTTCATAAAGCTG
9913	medline	17442748
9914	class	Unknown
9914	comment	-
9914	consensus	TTTCCATCATAAATC
9914	medline	17442748
9915	class	Unknown
9915	comment	-
9915	consensus	TGGAATTCAAAACACATT
9915	medline	17442748
9916	class	Unknown
9916	comment	-
9916	consensus	CCACATCTGGAAAAG
9916	medline	17442748
9917	class	Unknown
9917	comment	-
9917	consensus	TGGAAGCAGTGAAACAAATG
9917	medline	17442748
9918	class	Unknown
9918	comment	-
9918	consensus	TGTTGATTCTTTCCAGGAAA
9918	medline	17442748
9919	class	Unknown
9919	comment	-
9919	jaspar	-
9919	mcs	107.8
9919	medline	15735639
9919	tax_group	vertebrates
9919	transfac	NRF-1
9919	type	phylogenetic
9920	class	Unknown
9920	comment	-
9920	jaspar	-
9920	mcs	85.3
9920	medline	15735639
9920	tax_group	vertebrates
9920	transfac	MYC
9920	type	phylogenetic
9921	class	Unknown
9921	comment	-
9921	jaspar	ELK4
9921	mcs	80.4
9921	medline	15735639
9921	tax_group	vertebrates
9921	transfac	ELK-1
9921	type	phylogenetic
9922	class	Unknown
9922	comment	-
9922	jaspar	-
9922	mcs	69.5
9922	medline	15735639
9922	tax_group	vertebrates
9922	transfac	-
9922	type	phylogenetic
9923	class	Unknown
9923	comment	-
9923	jaspar	NF-Y
9923	mcs	64.6
9923	medline	15735639
9923	tax_group	vertebrates
9923	transfac	NF-Y
9923	type	phylogenetic
9924	class	Unknown
9924	comment	-
9924	jaspar	SP1
9924	mcs	63.9
9924	medline	15735639
9924	tax_group	vertebrates
9924	transfac	SP1
9924	type	phylogenetic
9925	class	Unknown
9925	comment	-
9925	jaspar	Fos
9925	mcs	62.8
9925	medline	15735639
9925	tax_group	vertebrates
9925	transfac	AP-1
9925	type	phylogenetic
9926	class	Unknown
9926	comment	-
9926	jaspar	-
9926	mcs	55.7
9926	medline	15735639
9926	tax_group	vertebrates
9926	transfac	-
9926	type	phylogenetic
9927	class	Unknown
9927	comment	-
9927	jaspar	-
9927	mcs	55.7
9927	medline	15735639
9927	tax_group	vertebrates
9927	transfac	ATF3
9927	type	phylogenetic
9928	class	Unknown
9928	comment	-
9928	jaspar	-
9928	mcs	54.7
9928	medline	15735639
9928	tax_group	vertebrates
9928	transfac	YY1
9928	type	phylogenetic
9929	class	Unknown
9929	comment	-
9929	jaspar	GABPA
9929	mcs	51.6
9929	medline	15735639
9929	tax_group	vertebrates
9929	transfac	GABP
9929	type	phylogenetic
9930	class	Unknown
9930	comment	-
9930	jaspar	ESR1
9930	mcs	47.6
9930	medline	15735639
9930	tax_group	vertebrates
9930	transfac	E12
9930	type	phylogenetic
9931	class	Unknown
9931	comment	-
9931	jaspar	-
9931	mcs	46.0
9931	medline	15735639
9931	tax_group	vertebrates
9931	transfac	LEF1
9931	type	phylogenetic
9932	class	Unknown
9932	comment	-
9932	jaspar	-
9932	mcs	44.8
9932	medline	15735639
9932	tax_group	vertebrates
9932	transfac	ATF3
9932	type	phylogenetic
9933	class	Unknown
9933	comment	-
9933	jaspar	NHLH1
9933	mcs	43.9
9933	medline	15735639
9933	tax_group	vertebrates
9933	transfac	AP-4
9933	type	phylogenetic
9934	class	Unknown
9934	comment	-
9934	jaspar	-
9934	mcs	43.0
9934	medline	15735639
9934	tax_group	vertebrates
9934	transfac	C-ETS-2
9934	type	phylogenetic
9935	class	Unknown
9935	comment	-
9935	jaspar	NR2F1
9935	mcs	42.1
9935	medline	15735639
9935	tax_group	vertebrates
9935	transfac	IRF1(*)
9935	type	phylogenetic
9936	class	Unknown
9936	comment	-
9936	jaspar	-
9936	mcs	40.4
9936	medline	15735639
9936	tax_group	vertebrates
9936	transfac	SREBP-1
9936	type	phylogenetic
9937	class	Unknown
9937	comment	-
9937	jaspar	-
9937	mcs	40.1
9937	medline	15735639
9937	tax_group	vertebrates
9937	transfac	-
9937	type	phylogenetic
9938	class	Unknown
9938	comment	-
9938	jaspar	CREB1
9938	mcs	38.4
9938	medline	15735639
9938	tax_group	vertebrates
9938	transfac	E4F1
9938	type	phylogenetic
9939	class	Unknown
9939	comment	-
9939	jaspar	-
9939	mcs	37.7
9939	medline	15735639
9939	tax_group	vertebrates
9939	transfac	-
9939	type	phylogenetic
9940	class	Unknown
9940	comment	-
9940	jaspar	-
9940	mcs	37.4
9940	medline	15735639
9940	tax_group	vertebrates
9940	transfac	-
9940	type	phylogenetic
9941	class	Unknown
9941	comment	-
9941	jaspar	TCF1
9941	mcs	37.3
9941	medline	15735639
9941	tax_group	vertebrates
9941	transfac	CHX10
9941	type	phylogenetic
9942	class	Unknown
9942	comment	-
9942	jaspar	-
9942	mcs	33.5
9942	medline	15735639
9942	tax_group	vertebrates
9942	transfac	MAZ
9942	type	phylogenetic
9943	class	Unknown
9943	comment	-
9943	jaspar	-
9943	mcs	33.4
9943	medline	15735639
9943	tax_group	vertebrates
9943	transfac	ESRRA
9943	type	phylogenetic
9944	class	Unknown
9944	comment	-
9944	jaspar	NFIL3
9944	mcs	32.6
9944	medline	15735639
9944	tax_group	vertebrates
9944	transfac	E4BP4
9944	type	phylogenetic
9945	class	Unknown
9945	comment	-
9945	jaspar	-
9945	mcs	32.3
9945	medline	15735639
9945	tax_group	vertebrates
9945	transfac	-
9945	type	phylogenetic
9946	class	Unknown
9946	comment	-
9946	jaspar	MEF2A
9946	mcs	32.3
9946	medline	15735639
9946	tax_group	vertebrates
9946	transfac	RSRFC4
9946	type	phylogenetic
9947	class	Unknown
9947	comment	-
9947	jaspar	-
9947	mcs	30.8
9947	medline	15735639
9947	tax_group	vertebrates
9947	transfac	-
9947	type	phylogenetic
9948	class	Unknown
9948	comment	-
9948	jaspar	-
9948	mcs	30.5
9948	medline	15735639
9948	tax_group	vertebrates
9948	transfac	-
9948	type	phylogenetic
9949	class	Unknown
9949	comment	-
9949	jaspar	-
9949	mcs	30.0
9949	medline	15735639
9949	tax_group	vertebrates
9949	transfac	-
9949	type	phylogenetic
9950	class	Unknown
9950	comment	-
9950	jaspar	-
9950	mcs	27.2
9950	medline	15735639
9950	tax_group	vertebrates
9950	transfac	NF-E2
9950	type	phylogenetic
9951	class	Unknown
9951	comment	-
9951	jaspar	-
9951	mcs	26.4
9951	medline	15735639
9951	tax_group	vertebrates
9951	transfac	MEF-2
9951	type	phylogenetic
9952	class	Unknown
9952	comment	-
9952	jaspar	-
9952	mcs	26.1
9952	medline	15735639
9952	tax_group	vertebrates
9952	transfac	-
9952	type	phylogenetic
9953	class	Unknown
9953	comment	-
9953	jaspar	Myf
9953	mcs	25.7
9953	medline	15735639
9953	tax_group	vertebrates
9953	transfac	MYOD
9953	type	phylogenetic
9954	class	Unknown
9954	comment	-
9954	jaspar	-
9954	mcs	25.6
9954	medline	15735639
9954	tax_group	vertebrates
9954	transfac	FREAC-2
9954	type	phylogenetic
9955	class	Unknown
9955	comment	-
9955	jaspar	-
9955	mcs	25.3
9955	medline	15735639
9955	tax_group	vertebrates
9955	transfac	-
9955	type	phylogenetic
9956	class	Unknown
9956	comment	-
9956	jaspar	RORA
9956	mcs	25.2
9956	medline	15735639
9956	tax_group	vertebrates
9956	transfac	ERRALPHA
9956	type	phylogenetic
9957	class	Unknown
9957	comment	-
9957	jaspar	-
9957	mcs	24.3
9957	medline	15735639
9957	tax_group	vertebrates
9957	transfac	-
9957	type	phylogenetic
9958	class	Unknown
9958	comment	-
9958	jaspar	-
9958	mcs	24.3
9958	medline	15735639
9958	tax_group	vertebrates
9958	transfac	STAT5A
9958	type	phylogenetic
9959	class	Unknown
9959	comment	-
9959	jaspar	-
9959	mcs	24.1
9959	medline	15735639
9959	tax_group	vertebrates
9959	transfac	MEIS1
9959	type	phylogenetic
9960	class	Unknown
9960	comment	-
9960	jaspar	-
9960	mcs	23.8
9960	medline	15735639
9960	tax_group	vertebrates
9960	transfac	-
9960	type	phylogenetic
9961	class	Unknown
9961	comment	-
9961	jaspar	-
9961	mcs	23.7
9961	medline	15735639
9961	tax_group	vertebrates
9961	transfac	-
9961	type	phylogenetic
9962	class	Unknown
9962	comment	-
9962	jaspar	-
9962	mcs	23.5
9962	medline	15735639
9962	tax_group	vertebrates
9962	transfac	OCT-X
9962	type	phylogenetic
9963	class	Unknown
9963	comment	-
9963	jaspar	-
9963	mcs	23.4
9963	medline	15735639
9963	tax_group	vertebrates
9963	transfac	-
9963	type	phylogenetic
9964	class	Unknown
9964	comment	-
9964	jaspar	-
9964	mcs	23.0
9964	medline	15735639
9964	tax_group	vertebrates
9964	transfac	-
9964	type	phylogenetic
9965	class	Unknown
9965	comment	-
9965	jaspar	Hox11-CTF1
9965	mcs	22.9
9965	medline	15735639
9965	tax_group	vertebrates
9965	transfac	NF-1
9965	type	phylogenetic
9966	class	Unknown
9966	comment	-
9966	jaspar	-
9966	mcs	22.8
9966	medline	15735639
9966	tax_group	vertebrates
9966	transfac	C-REL(*)
9966	type	phylogenetic
9967	class	Unknown
9967	comment	-
9967	jaspar	SOX9
9967	mcs	22.5
9967	medline	15735639
9967	tax_group	vertebrates
9967	transfac	SOX-9
9967	type	phylogenetic
9968	class	Unknown
9968	comment	-
9968	jaspar	-
9968	mcs	22.4
9968	medline	15735639
9968	tax_group	vertebrates
9968	transfac	PU.1
9968	type	phylogenetic
9969	class	Unknown
9969	comment	-
9969	jaspar	TBP
9969	mcs	22.1
9969	medline	15735639
9969	tax_group	vertebrates
9969	transfac	TATA
9969	type	phylogenetic
9970	class	Unknown
9970	comment	-
9970	jaspar	-
9970	mcs	21.6
9970	medline	15735639
9970	tax_group	vertebrates
9970	transfac	POU1F1(*)
9970	type	phylogenetic
9971	class	Unknown
9971	comment	-
9971	jaspar	-
9971	mcs	21.3
9971	medline	15735639
9971	tax_group	vertebrates
9971	transfac	MIF-1
9971	type	phylogenetic
9972	class	Unknown
9972	comment	-
9972	jaspar	-
9972	mcs	21.1
9972	medline	15735639
9972	tax_group	vertebrates
9972	transfac	RSRFC4
9972	type	phylogenetic
9973	class	Unknown
9973	comment	-
9973	jaspar	-
9973	mcs	21.1
9973	medline	15735639
9973	tax_group	vertebrates
9973	transfac	NF-AT
9973	type	phylogenetic
9974	class	Unknown
9974	comment	-
9974	jaspar	-
9974	mcs	20.9
9974	medline	15735639
9974	tax_group	vertebrates
9974	transfac	PAX-4
9974	type	phylogenetic
9975	class	Unknown
9975	comment	-
9975	jaspar	-
9975	mcs	20.7
9975	medline	15735639
9975	tax_group	vertebrates
9975	transfac	-
9975	type	phylogenetic
9976	class	Unknown
9976	comment	-
9976	jaspar	-
9976	mcs	20.3
9976	medline	15735639
9976	tax_group	vertebrates
9976	transfac	IPF1(*)
9976	type	phylogenetic
9977	class	Unknown
9977	comment	-
9977	jaspar	-
9977	mcs	19.9
9977	medline	15735639
9977	tax_group	vertebrates
9977	transfac	-
9977	type	phylogenetic
9978	class	Unknown
9978	comment	-
9978	jaspar	FOXF2
9978	mcs	19.8
9978	medline	15735639
9978	tax_group	vertebrates
9978	transfac	FOXO4
9978	type	phylogenetic
9979	class	Unknown
9979	comment	-
9979	jaspar	-
9979	mcs	19.8
9979	medline	15735639
9979	tax_group	vertebrates
9979	transfac	LHX3
9979	type	phylogenetic
9980	class	Unknown
9980	comment	-
9980	jaspar	-
9980	mcs	19.1
9980	medline	15735639
9980	tax_group	vertebrates
9980	transfac	-
9980	type	phylogenetic
9981	class	Unknown
9981	comment	-
9981	jaspar	-
9981	mcs	19.1
9981	medline	15735639
9981	tax_group	vertebrates
9981	transfac	-
9981	type	phylogenetic
9982	class	Unknown
9982	comment	-
9982	jaspar	-
9982	mcs	18.8
9982	medline	15735639
9982	tax_group	vertebrates
9982	transfac	AP-1(*)
9982	type	phylogenetic
9983	class	Unknown
9983	comment	-
9983	jaspar	-
9983	mcs	18.7
9983	medline	15735639
9983	tax_group	vertebrates
9983	transfac	FXR(*)
9983	type	phylogenetic
9984	class	Unknown
9984	comment	-
9984	jaspar	-
9984	mcs	18.5
9984	medline	15735639
9984	tax_group	vertebrates
9984	transfac	-
9984	type	phylogenetic
9985	class	Unknown
9985	comment	-
9985	jaspar	-
9985	mcs	17.5
9985	medline	15735639
9985	tax_group	vertebrates
9985	transfac	TCF11/MAFG
9985	type	phylogenetic
9986	class	Unknown
9986	comment	-
9986	jaspar	-
9986	mcs	17.4
9986	medline	15735639
9986	tax_group	vertebrates
9986	transfac	HSF1
9986	type	phylogenetic
9987	class	Unknown
9987	comment	-
9987	jaspar	-
9987	mcs	17.3
9987	medline	15735639
9987	tax_group	vertebrates
9987	transfac	E2F-1/DP-2
9987	type	phylogenetic
9988	class	Unknown
9988	comment	-
9988	jaspar	-
9988	mcs	17.2
9988	medline	15735639
9988	tax_group	vertebrates
9988	transfac	PAX-3
9988	type	phylogenetic
9989	class	Unknown
9989	comment	-
9989	jaspar	-
9989	mcs	17.1
9989	medline	15735639
9989	tax_group	vertebrates
9989	transfac	-
9989	type	phylogenetic
9990	class	Unknown
9990	comment	-
9990	jaspar	-
9990	mcs	17.1
9990	medline	15735639
9990	tax_group	vertebrates
9990	transfac	-
9990	type	phylogenetic
9991	class	Unknown
9991	comment	-
9991	jaspar	NR1H2-RXR
9991	mcs	17.0
9991	medline	15735639
9991	tax_group	vertebrates
9991	transfac	LEF1
9991	type	phylogenetic
9992	class	Unknown
9992	comment	-
9992	jaspar	-
9992	mcs	16.7
9992	medline	15735639
9992	tax_group	vertebrates
9992	transfac	-
9992	type	phylogenetic
9993	class	Unknown
9993	comment	-
9993	jaspar	-
9993	mcs	16.5
9993	medline	15735639
9993	tax_group	vertebrates
9993	transfac	STAT1(*)
9993	type	phylogenetic
9994	class	Unknown
9994	comment	-
9994	jaspar	-
9994	mcs	16.3
9994	medline	15735639
9994	tax_group	vertebrates
9994	transfac	AREB6
9994	type	phylogenetic
9995	class	Unknown
9995	comment	-
9995	jaspar	-
9995	mcs	16.3
9995	medline	15735639
9995	tax_group	vertebrates
9995	transfac	-
9995	type	phylogenetic
9996	class	Unknown
9996	comment	-
9996	jaspar	-
9996	mcs	16.2
9996	medline	15735639
9996	tax_group	vertebrates
9996	transfac	-
9996	type	phylogenetic
9997	class	Unknown
9997	comment	-
9997	jaspar	TEAD
9997	mcs	16.1
9997	medline	15735639
9997	tax_group	vertebrates
9997	transfac	TEF-1
9997	type	phylogenetic
9998	class	Unknown
9998	comment	-
9998	jaspar	-
9998	mcs	15.8
9998	medline	15735639
9998	tax_group	vertebrates
9998	transfac	-
9998	type	phylogenetic
9999	class	Unknown
9999	comment	-
9999	jaspar	-
9999	mcs	15.7
9999	medline	15735639
9999	tax_group	vertebrates
9999	transfac	-
9999	type	phylogenetic
10000	class	Unknown
10000	comment	-
10000	jaspar	-
10000	mcs	15.5
10000	medline	15735639
10000	tax_group	vertebrates
10000	transfac	-
10000	type	phylogenetic
10001	class	Unknown
10001	comment	-
10001	jaspar	Foxd3
10001	mcs	15.1
10001	medline	15735639
10001	tax_group	vertebrates
10001	transfac	HNF-3
10001	type	phylogenetic
10002	class	Unknown
10002	comment	-
10002	jaspar	-
10002	mcs	15.0
10002	medline	15735639
10002	tax_group	vertebrates
10002	transfac	HNF-1
10002	type	phylogenetic
10003	class	Unknown
10003	comment	-
10003	jaspar	IRF2
10003	mcs	14.9
10003	medline	15735639
10003	tax_group	vertebrates
10003	transfac	IRF
10003	type	phylogenetic
10004	class	Unknown
10004	comment	-
10004	jaspar	RELA
10004	mcs	14.9
10004	medline	15735639
10004	tax_group	vertebrates
10004	transfac	NF-KAPPAB
10004	type	phylogenetic
10005	class	Unknown
10005	comment	-
10005	jaspar	-
10005	mcs	14.6
10005	medline	15735639
10005	tax_group	vertebrates
10005	transfac	-
10005	type	phylogenetic
10006	class	Unknown
10006	comment	-
10006	jaspar	-
10006	mcs	14.3
10006	medline	15735639
10006	tax_group	vertebrates
10006	transfac	-
10006	type	phylogenetic
10007	class	Unknown
10007	comment	-
10007	jaspar	-
10007	mcs	14.3
10007	medline	15735639
10007	tax_group	vertebrates
10007	transfac	-
10007	type	phylogenetic
10008	class	Unknown
10008	comment	-
10008	jaspar	-
10008	mcs	14.3
10008	medline	15735639
10008	tax_group	vertebrates
10008	transfac	CART-1(*)
10008	type	phylogenetic
10009	class	Unknown
10009	comment	-
10009	jaspar	RREB1
10009	mcs	14.1
10009	medline	15735639
10009	tax_group	vertebrates
10009	transfac	-
10009	type	phylogenetic
10010	class	Unknown
10010	comment	-
10010	jaspar	MafB
10010	mcs	14.0
10010	medline	15735639
10010	tax_group	vertebrates
10010	transfac	-
10010	type	phylogenetic
10011	class	Unknown
10011	comment	-
10011	jaspar	-
10011	mcs	14.0
10011	medline	15735639
10011	tax_group	vertebrates
10011	transfac	PITX2
10011	type	phylogenetic
10012	class	Unknown
10012	comment	-
10012	jaspar	Gfi
10012	mcs	13.9
10012	medline	15735639
10012	tax_group	vertebrates
10012	transfac	GFI-1
10012	type	phylogenetic
10013	class	Unknown
10013	comment	-
10013	jaspar	-
10013	mcs	13.7
10013	medline	15735639
10013	tax_group	vertebrates
10013	transfac	-
10013	type	phylogenetic
10014	class	Unknown
10014	comment	-
10014	jaspar	-
10014	mcs	13.7
10014	medline	15735639
10014	tax_group	vertebrates
10014	transfac	-
10014	type	phylogenetic
10015	class	Unknown
10015	comment	-
10015	jaspar	-
10015	mcs	13.7
10015	medline	15735639
10015	tax_group	vertebrates
10015	transfac	CDP(*)
10015	type	phylogenetic
10016	class	Unknown
10016	comment	-
10016	jaspar	-
10016	mcs	13.6
10016	medline	15735639
10016	tax_group	vertebrates
10016	transfac	-
10016	type	phylogenetic
10017	class	Unknown
10017	comment	-
10017	jaspar	-
10017	mcs	13.3
10017	medline	15735639
10017	tax_group	vertebrates
10017	transfac	-
10017	type	phylogenetic
10018	class	Unknown
10018	comment	-
10018	jaspar	-
10018	mcs	13.3
10018	medline	15735639
10018	tax_group	vertebrates
10018	transfac	-
10018	type	phylogenetic
10019	class	Unknown
10019	comment	-
10019	jaspar	-
10019	mcs	13.2
10019	medline	15735639
10019	tax_group	vertebrates
10019	transfac	-
10019	type	phylogenetic
10020	class	Unknown
10020	comment	-
10020	jaspar	-
10020	mcs	13.2
10020	medline	15735639
10020	tax_group	vertebrates
10020	transfac	-
10020	type	phylogenetic
10021	class	Unknown
10021	comment	-
10021	jaspar	-
10021	mcs	13.1
10021	medline	15735639
10021	tax_group	vertebrates
10021	transfac	-
10021	type	phylogenetic
10022	class	Unknown
10022	comment	-
10022	jaspar	-
10022	mcs	13.0
10022	medline	15735639
10022	tax_group	vertebrates
10022	transfac	-
10022	type	phylogenetic
10023	class	Unknown
10023	comment	-
10023	jaspar	-
10023	mcs	13.0
10023	medline	15735639
10023	tax_group	vertebrates
10023	transfac	-
10023	type	phylogenetic
10024	class	Unknown
10024	comment	-
10024	jaspar	-
10024	mcs	12.9
10024	medline	15735639
10024	tax_group	vertebrates
10024	transfac	-
10024	type	phylogenetic
10025	class	Unknown
10025	comment	-
10025	jaspar	-
10025	mcs	12.8
10025	medline	15735639
10025	tax_group	vertebrates
10025	transfac	-
10025	type	phylogenetic
10026	class	Unknown
10026	comment	-
10026	jaspar	-
10026	mcs	12.7
10026	medline	15735639
10026	tax_group	vertebrates
10026	transfac	FAC1(*)
10026	type	phylogenetic
10027	class	Unknown
10027	comment	-
10027	jaspar	-
10027	mcs	12.7
10027	medline	15735639
10027	tax_group	vertebrates
10027	transfac	-
10027	type	phylogenetic
10028	class	Unknown
10028	comment	-
10028	jaspar	-
10028	mcs	12.5
10028	medline	15735639
10028	tax_group	vertebrates
10028	transfac	-
10028	type	phylogenetic
10029	class	Unknown
10029	comment	-
10029	jaspar	RUNX1
10029	mcs	12.3
10029	medline	15735639
10029	tax_group	vertebrates
10029	transfac	AML
10029	type	phylogenetic
10030	class	Unknown
10030	comment	-
10030	jaspar	-
10030	mcs	12.3
10030	medline	15735639
10030	tax_group	vertebrates
10030	transfac	-
10030	type	phylogenetic
10031	class	Unknown
10031	comment	-
10031	jaspar	-
10031	mcs	12.3
10031	medline	15735639
10031	tax_group	vertebrates
10031	transfac	-
10031	type	phylogenetic
10032	class	Unknown
10032	comment	-
10032	jaspar	-
10032	mcs	12.2
10032	medline	15735639
10032	tax_group	vertebrates
10032	transfac	-
10032	type	phylogenetic
10033	class	Unknown
10033	comment	-
10033	jaspar	-
10033	mcs	12.2
10033	medline	15735639
10033	tax_group	vertebrates
10033	transfac	-
10033	type	phylogenetic
10034	class	Unknown
10034	comment	-
10034	jaspar	-
10034	mcs	12.2
10034	medline	15735639
10034	tax_group	vertebrates
10034	transfac	-
10034	type	phylogenetic
10035	class	Unknown
10035	comment	-
10035	jaspar	-
10035	mcs	12.1
10035	medline	15735639
10035	tax_group	vertebrates
10035	transfac	-
10035	type	phylogenetic
10036	class	Unknown
10036	comment	-
10036	jaspar	-
10036	mcs	12.0
10036	medline	15735639
10036	tax_group	vertebrates
10036	transfac	-
10036	type	phylogenetic
10037	class	Unknown
10037	comment	-
10037	jaspar	-
10037	mcs	11.9
10037	medline	15735639
10037	tax_group	vertebrates
10037	transfac	-
10037	type	phylogenetic
10038	class	Unknown
10038	comment	-
10038	jaspar	-
10038	mcs	11.8
10038	medline	15735639
10038	tax_group	vertebrates
10038	transfac	-
10038	type	phylogenetic
10039	class	Unknown
10039	comment	-
10039	jaspar	SRF
10039	mcs	11.7
10039	medline	15735639
10039	tax_group	vertebrates
10039	transfac	SRF
10039	type	phylogenetic
10040	class	Unknown
10040	comment	-
10040	jaspar	-
10040	mcs	11.7
10040	medline	15735639
10040	tax_group	vertebrates
10040	transfac	-
10040	type	phylogenetic
10041	class	Unknown
10041	comment	-
10041	jaspar	-
10041	mcs	11.6
10041	medline	15735639
10041	tax_group	vertebrates
10041	transfac	-
10041	type	phylogenetic
10042	class	Unknown
10042	comment	-
10042	jaspar	-
10042	mcs	11.5
10042	medline	15735639
10042	tax_group	vertebrates
10042	transfac	-
10042	type	phylogenetic
10043	class	Unknown
10043	comment	-
10043	jaspar	-
10043	mcs	11.5
10043	medline	15735639
10043	tax_group	vertebrates
10043	transfac	-
10043	type	phylogenetic
10044	class	Unknown
10044	comment	-
10044	jaspar	-
10044	mcs	11.4
10044	medline	15735639
10044	tax_group	vertebrates
10044	transfac	-
10044	type	phylogenetic
10045	class	Unknown
10045	comment	-
10045	jaspar	-
10045	mcs	11.3
10045	medline	15735639
10045	tax_group	vertebrates
10045	transfac	-
10045	type	phylogenetic
10046	class	Unknown
10046	comment	-
10046	jaspar	-
10046	mcs	11.3
10046	medline	15735639
10046	tax_group	vertebrates
10046	transfac	-
10046	type	phylogenetic
10047	class	Unknown
10047	comment	-
10047	jaspar	-
10047	mcs	11.2
10047	medline	15735639
10047	tax_group	vertebrates
10047	transfac	-
10047	type	phylogenetic
10048	class	Unknown
10048	comment	-
10048	jaspar	-
10048	mcs	11.2
10048	medline	15735639
10048	tax_group	vertebrates
10048	transfac	OLF-1
10048	type	phylogenetic
10049	class	Unknown
10049	comment	-
10049	jaspar	Evi1
10049	mcs	11.2
10049	medline	15735639
10049	tax_group	vertebrates
10049	transfac	GATA-X
10049	type	phylogenetic
10050	class	Unknown
10050	comment	-
10050	jaspar	-
10050	mcs	11.1
10050	medline	15735639
10050	tax_group	vertebrates
10050	transfac	-
10050	type	phylogenetic
10051	class	Unknown
10051	comment	-
10051	jaspar	-
10051	mcs	11.1
10051	medline	15735639
10051	tax_group	vertebrates
10051	transfac	-
10051	type	phylogenetic
10052	class	Unknown
10052	comment	-
10052	jaspar	-
10052	mcs	11.1
10052	medline	15735639
10052	tax_group	vertebrates
10052	transfac	-
10052	type	phylogenetic
10053	class	Unknown
10053	comment	-
10053	jaspar	-
10053	mcs	11.1
10053	medline	15735639
10053	tax_group	vertebrates
10053	transfac	-
10053	type	phylogenetic
10054	class	Unknown
10054	comment	-
10054	jaspar	-
10054	mcs	11.0
10054	medline	15735639
10054	tax_group	vertebrates
10054	transfac	-
10054	type	phylogenetic
10055	class	Unknown
10055	comment	-
10055	jaspar	-
10055	mcs	11.0
10055	medline	15735639
10055	tax_group	vertebrates
10055	transfac	-
10055	type	phylogenetic
10056	class	Unknown
10056	comment	-
10056	jaspar	-
10056	mcs	11.0
10056	medline	15735639
10056	tax_group	vertebrates
10056	transfac	-
10056	type	phylogenetic
10057	class	Unknown
10057	comment	-
10057	jaspar	FOXI1
10057	mcs	11.0
10057	medline	15735639
10057	tax_group	vertebrates
10057	transfac	HFH-4
10057	type	phylogenetic
10058	class	Unknown
10058	comment	-
10058	jaspar	-
10058	mcs	10.9
10058	medline	15735639
10058	tax_group	vertebrates
10058	transfac	-
10058	type	phylogenetic
10059	class	Unknown
10059	comment	-
10059	jaspar	-
10059	mcs	10.9
10059	medline	15735639
10059	tax_group	vertebrates
10059	transfac	HSF
10059	type	phylogenetic
10060	class	Unknown
10060	comment	-
10060	jaspar	-
10060	mcs	10.9
10060	medline	15735639
10060	tax_group	vertebrates
10060	transfac	-
10060	type	phylogenetic
10061	class	Unknown
10061	comment	-
10061	jaspar	-
10061	mcs	10.8
10061	medline	15735639
10061	tax_group	vertebrates
10061	transfac	-
10061	type	phylogenetic
10062	class	Unknown
10062	comment	-
10062	jaspar	-
10062	mcs	10.8
10062	medline	15735639
10062	tax_group	vertebrates
10062	transfac	-
10062	type	phylogenetic
10063	class	Unknown
10063	comment	-
10063	jaspar	-
10063	mcs	10.7
10063	medline	15735639
10063	tax_group	vertebrates
10063	transfac	-
10063	type	phylogenetic
10064	class	Unknown
10064	comment	-
10064	jaspar	-
10064	mcs	10.5
10064	medline	15735639
10064	tax_group	vertebrates
10064	transfac	-
10064	type	phylogenetic
10065	class	Unknown
10065	comment	-
10065	jaspar	-
10065	mcs	10.5
10065	medline	15735639
10065	tax_group	vertebrates
10065	transfac	-
10065	type	phylogenetic
10066	class	Unknown
10066	comment	-
10066	jaspar	-
10066	mcs	10.5
10066	medline	15735639
10066	tax_group	vertebrates
10066	transfac	-
10066	type	phylogenetic
10067	class	Unknown
10067	comment	-
10067	jaspar	-
10067	mcs	10.4
10067	medline	15735639
10067	tax_group	vertebrates
10067	transfac	-
10067	type	phylogenetic
10068	class	Unknown
10068	comment	-
10068	jaspar	-
10068	mcs	10.4
10068	medline	15735639
10068	tax_group	vertebrates
10068	transfac	-
10068	type	phylogenetic
10069	class	Unknown
10069	comment	-
10069	jaspar	-
10069	mcs	10.4
10069	medline	15735639
10069	tax_group	vertebrates
10069	transfac	-
10069	type	phylogenetic
10070	class	Unknown
10070	comment	-
10070	jaspar	-
10070	mcs	10.3
10070	medline	15735639
10070	tax_group	vertebrates
10070	transfac	-
10070	type	phylogenetic
10071	class	Unknown
10071	comment	-
10071	jaspar	-
10071	mcs	10.3
10071	medline	15735639
10071	tax_group	vertebrates
10071	transfac	-
10071	type	phylogenetic
10072	class	Unknown
10072	comment	-
10072	jaspar	-
10072	mcs	10.2
10072	medline	15735639
10072	tax_group	vertebrates
10072	transfac	-
10072	type	phylogenetic
10073	class	Unknown
10073	comment	-
10073	jaspar	-
10073	mcs	10.2
10073	medline	15735639
10073	tax_group	vertebrates
10073	transfac	-
10073	type	phylogenetic
10074	class	Unknown
10074	comment	-
10074	jaspar	-
10074	mcs	10.2
10074	medline	15735639
10074	tax_group	vertebrates
10074	transfac	-
10074	type	phylogenetic
10075	class	Unknown
10075	comment	-
10075	jaspar	-
10075	mcs	10.2
10075	medline	15735639
10075	tax_group	vertebrates
10075	transfac	-
10075	type	phylogenetic
10076	class	Unknown
10076	comment	-
10076	jaspar	-
10076	mcs	10.2
10076	medline	15735639
10076	tax_group	vertebrates
10076	transfac	-
10076	type	phylogenetic
10077	class	Unknown
10077	comment	-
10077	jaspar	-
10077	mcs	9.9
10077	medline	15735639
10077	tax_group	vertebrates
10077	transfac	-
10077	type	phylogenetic
10078	class	Unknown
10078	comment	-
10078	jaspar	-
10078	mcs	9.9
10078	medline	15735639
10078	tax_group	vertebrates
10078	transfac	-
10078	type	phylogenetic
10079	class	Unknown
10079	comment	-
10079	jaspar	-
10079	mcs	9.8
10079	medline	15735639
10079	tax_group	vertebrates
10079	transfac	-
10079	type	phylogenetic
10080	class	Unknown
10080	comment	-
10080	jaspar	-
10080	mcs	9.8
10080	medline	15735639
10080	tax_group	vertebrates
10080	transfac	-
10080	type	phylogenetic
10081	class	Unknown
10081	comment	-
10081	jaspar	-
10081	mcs	9.8
10081	medline	15735639
10081	tax_group	vertebrates
10081	transfac	-
10081	type	phylogenetic
10082	class	Unknown
10082	comment	-
10082	jaspar	-
10082	mcs	9.8
10082	medline	15735639
10082	tax_group	vertebrates
10082	transfac	-
10082	type	phylogenetic
10083	class	Unknown
10083	comment	-
10083	jaspar	-
10083	mcs	9.8
10083	medline	15735639
10083	tax_group	vertebrates
10083	transfac	-
10083	type	phylogenetic
10084	class	Unknown
10084	comment	-
10084	jaspar	-
10084	mcs	9.6
10084	medline	15735639
10084	tax_group	vertebrates
10084	transfac	-
10084	type	phylogenetic
10085	class	Unknown
10085	comment	-
10085	jaspar	-
10085	mcs	9.6
10085	medline	15735639
10085	tax_group	vertebrates
10085	transfac	-
10085	type	phylogenetic
10086	class	Unknown
10086	comment	-
10086	jaspar	-
10086	mcs	9.5
10086	medline	15735639
10086	tax_group	vertebrates
10086	transfac	-
10086	type	phylogenetic
10087	class	Unknown
10087	comment	-
10087	jaspar	-
10087	mcs	9.5
10087	medline	15735639
10087	tax_group	vertebrates
10087	transfac	-
10087	type	phylogenetic
10088	class	Unknown
10088	comment	-
10088	jaspar	-
10088	mcs	9.1
10088	medline	15735639
10088	tax_group	vertebrates
10088	transfac	-
10088	type	phylogenetic
10089	class	Unknown
10089	comment	-
10089	jaspar	-
10089	mcs	9.1
10089	medline	15735639
10089	tax_group	vertebrates
10089	transfac	-
10089	type	phylogenetic
10090	class	Unknown
10090	comment	-
10090	jaspar	-
10090	mcs	9.0
10090	medline	15735639
10090	tax_group	vertebrates
10090	transfac	C/EBPBETA
10090	type	phylogenetic
10091	class	Unknown
10091	comment	-
10091	jaspar	-
10091	mcs	8.8
10091	medline	15735639
10091	tax_group	vertebrates
10091	transfac	-
10091	type	phylogenetic
10092	class	Unknown
10092	comment	-
10092	jaspar	-
10092	mcs	8.1
10092	medline	15735639
10092	tax_group	vertebrates
10092	transfac	-
10092	type	phylogenetic
10093	class	Unknown
10093	comment	-
10623	description	NK2 homeobox 5
10093	medline	15475254
10094	class	Unknown
10094	comment	-
10624	description	nuclear receptor subfamily 2,group C,member 2
10094	medline	15475254
10095	class	Unknown
10095	comment	-
10625	description	nuclear receptor subfamily 5,group A,member 2
10095	medline	15475254
10096	class	Unknown
10096	comment	-
10626	description	nuclear respiratory factor 1
10096	medline	15475254
10097	class	Unknown
10097	comment	-
10627	description	POU class 2 homeobox 2
10097	medline	15475254
10098	class	Unknown
10098	comment	-
10628	description	PR domain containing 1,with ZNF domain
10098	medline	15475254
10099	class	Unknown
10099	comment	-
10629	description	regulatory factor X,1 (influences HLA class II expression)
10099	end_relative_to_tss	+33
10099	medline	15231738
10099	start_relative_to_tss	+15
10100	class	Unknown
10100	comment	-
10631	description	runt-related transcription factor 2
10630	description	regulatory factor X,5 (influences HLA class II expression)
10100	end_relative_to_tss	+6
10100	medline	2329577
10100	start_relative_to_tss	-2
10101	class	Unknown
10101	comment	-
10634	description	SRY (sex determining region Y)-box 3
10633	description	-
10632	description	retinoid X receptor,alpha
10101	end_relative_to_tss	-157 to +8
10101	medline	2329577
10101	start_relative_to_tss	-170 to -6
10102	class	Unknown
10102	comment	-
10636	description	Sp2 transcription factor
10635	description	SRY (sex determining region Y)-box 6
10102	end_relative_to_tss	-208 to -52
10102	medline	2329577
10102	start_relative_to_tss	-219 to -64
10103	class	Unknown
10103	comment	-
10639	description	-
10638	description	signal transducer and activator of transcription 4
10637	description	-
10103	end_relative_to_tss	+34
10103	medline	10848601
10103	start_relative_to_tss	+26
10104	class	Unknown
10104	comment	-
10576	description	ERR2,ERRbeta,NR3B2,ERRb
10104	end_relative_to_tss	-32
10104	medline	9420329
10104	start_relative_to_tss	-39
10105	class	Unknown
10105	comment	-
10578	description	LBP-9,CRTR1
10579	description	ZNF926
10105	end_relative_to_tss	-17
10105	medline	16230532
10105	start_relative_to_tss	-23
10106	class	Unknown
10106	comment	-
9404	description	cAMP responsive element binding protein 1
9405	description	-
9503	description	-
10526	description	SRY (sex determining region Y)-box 10
10106	end_relative_to_tss	+11
10106	medline	16227614
10106	start_relative_to_tss	+6
10107	class	Unknown
10107	comment	-
9398	description	nuclear receptor subfamily 4,group A,member 2
9399	description	nuclear factor I/C (CCAAT-binding transcription factor)
9401	description	pleiomorphic adenoma gene 1
9402	description	nuclear receptor subfamily 2,group E,member 3
10107	end_relative_to_tss	+21
10107	medline	16227614
10107	start_relative_to_tss	+16
10108	class	Unknown
10108	comment	-
9393	description	insulinoma-associated 1
9394	description	FEV (ETS oncogene family)
9395	description	forkhead box O3
9396	description	homeobox A5
9397	description	-
10108	end_relative_to_tss	+34
10108	medline	16227614
10108	start_relative_to_tss	+30
10109	class	Unknown
10109	comment	-
9390	description	nuclear factor of activated T-cells,cytoplasmic,calcineurin-dependent 2
9391	description	HNF1 homeobox B
10109	end_relative_to_tss	+2
10109	medline	17210644
10109	start_relative_to_tss	-8
10110	class	Unknown
10110	comment	-
9385	description	forkhead box A2
9386	description	estrogen receptor 1
9387	description	-
9389	description	AT rich interactive domain 3A (BRIGHT-like)
10110	end_relative_to_tss	-25 to -9
10110	medline	2329577
10110	start_relative_to_tss	-39 to -23
10111	class	Unknown
10111	comment	-
9380	description	Kruppel-like factor 4 (gut)
9381	description	RE1-silencing transcription factor
9382	description	runt-related transcription factor 1
10111	end_relative_to_tss	+6 to +116
10111	medline	8530439
10111	start_relative_to_tss	+1 to +110
10112	class	ETS
10112	comment	-
10112	included_models	MA0026,MA0028,MA0062,MA0076,MA0080,MA0081,MA0098
10112	medline	15066426
10112	type	METAMODEL
10113	class	bZIP
10113	comment	-
10113	included_models	MA0018,MA0089,MA0096,MA0097
10113	medline	15066426
10113	type	METAMODEL
10114	class	REL
10114	comment	-
10114	included_models	MA0022,MA0023,MA0061,MA0101,MA0105,MA0107
10114	medline	15066426
10114	type	METAMODEL
10115	class	Nuclear receptor
10115	comment	-
10115	included_models	MA0007,MA0016,MA0017,MA0065,MA0066,MA0071,MA0072,MA0074
10115	medline	15066426
10115	type	METAMODEL
10116	class	Forkhead
10116	comment	-
10116	included_models	MA0030,MA0031,MA0032,MA0033,MA0040,MA0041,MA0042,MA0047
10116	medline	15066426
10116	type	METAMODEL
10117	class	bZIP
10117	comment	-
10117	included_models	MA0019,MA0025,MA0043,MA0102
10117	medline	15066426
10117	type	METAMODEL
10118	class	bHLH(zip)
10118	comment	-
10118	included_models	MA0004,MA0006,MA0048,MA0055,MA0058, MA0059,MA0091,MA0092,MA0093,MA0104
10118	medline	15066426
10118	type	METAMODEL
10119	class	MADS
10119	comment	-
10119	included_models	MA0001,MA0005,MA0052,MA0082,MA0083
10119	medline	15066426
10119	type	METAMODEL
10120	class	TRP
10120	comment	-
10120	included_models	MA0034,MA0050,MA0051,MA0054,MA0100
10120	medline	15066426
10120	type	METAMODEL
10121	class	Homeo
10121	comment	-
10121	included_models	MA0008,MA0027,MA0046,MA0063,MA0068,MA0070,MA0075,MA0094
10121	medline	15066426
10121	type	METAMODEL
10122	class	HMG
10122	comment	-
10122	included_models	MA0044,MA0045,MA0077,MA0078,MA0084,MA0087
10122	medline	15066426
10122	type	METAMODEL
10123	class	Helix-Turn-Helix
10123	comment	Data is from Uniprobe database
10123	family	Arid
10123	medline	19443739
10123	pazar_tf_id	
10123	tax_group	vertebrates
10123	type	universal protein binding microarray (PBM)
10124	class	Helix-Turn-Helix
10124	comment	Data is from Uniprobe database
10124	family	Arid
10124	medline	19443739
10124	pazar_tf_id	
10124	tax_group	vertebrates
10124	type	universal protein binding microarray (PBM)
10125	class	Zipper-Type
10125	comment	Data is from Uniprobe database
10125	family	Helix-Loop-Helix
10125	medline	19443739
10125	pazar_tf_id	
10125	tax_group	vertebrates
10125	type	universal protein binding microarray (PBM)
10126	class	Zipper-Type
10126	comment	Data is from Uniprobe database
10126	family	Leucine Zipper
10126	medline	19443739
10126	pazar_tf_id	
10126	tax_group	vertebrates
10126	type	universal protein binding microarray (PBM)
10127	class	Other Alpha-Helix
10127	comment	Data is from Uniprobe database
10127	family	High Mobility Group box (HMG)
10127	medline	19443739
10127	pazar_tf_id	
10127	tax_group	vertebrates
10127	type	universal protein binding microarray (PBM)
10128	class	Zinc-coordinating
10128	comment	Data is from Uniprobe database
10128	family	BetaBetaAlpha-zinc finger
10128	medline	19443739
10128	pazar_tf_id	
10128	tax_group	vertebrates
10128	type	universal protein binding microarray (PBM)
10129	class	Zipper-Type
10129	comment	Data is from Uniprobe database
10129	family	Helix-Loop-Helix
10129	medline	19443739
10129	pazar_tf_id	
10129	tax_group	vertebrates
10129	type	universal protein binding microarray (PBM)
10130	class	Winged Helix-Turn-Helix
10130	comment	Data is from Uniprobe database
10130	family	E2F
10130	medline	19443739
10130	pazar_tf_id	
10130	tax_group	vertebrates
10130	type	universal protein binding microarray (PBM)
10131	class	Winged Helix-Turn-Helix
10131	comment	Data is from Uniprobe database
10131	family	E2F
10131	medline	19443739
10131	pazar_tf_id	
10131	tax_group	vertebrates
10131	type	universal protein binding microarray (PBM)
10132	class	Zinc-coordinating
10132	comment	Data is from Uniprobe database
10132	family	BetaBetaAlpha-zinc finger
10132	medline	19443739
10132	pazar_tf_id	
10132	tax_group	vertebrates
10132	type	universal protein binding microarray (PBM)
10133	class	Winged Helix-Turn-Helix
10133	comment	Data is from Uniprobe database
10133	family	Ets
10133	medline	19443739
10133	pazar_tf_id	
10133	tax_group	vertebrates
10133	type	universal protein binding microarray (PBM)
10134	class	Winged Helix-Turn-Helix
10134	comment	Data is from Uniprobe database
10134	family	Ets
10134	medline	19443739
10134	pazar_tf_id	
10134	tax_group	vertebrates
10134	type	universal protein binding microarray (PBM)
10135	class	Beta-Hairpin-Ribbon
10135	comment	Data is from Uniprobe database
10135	family	T
10135	medline	19443739
10135	pazar_tf_id	
10135	tax_group	vertebrates
10135	type	universal protein binding microarray (PBM)
10136	class	Zinc-coordinating
10136	comment	Data is from Uniprobe database
10136	family	Hormone-nuclear Receptor
10136	medline	19443739
10136	pazar_tf_id	
10136	tax_group	vertebrates
10136	type	universal protein binding microarray (PBM)
10137	class	Winged Helix-Turn-Helix
10137	comment	Data is from Uniprobe database
10137	family	Forkhead
10137	medline	19443739
10137	pazar_tf_id	
10137	tax_group	vertebrates
10137	type	universal protein binding microarray (PBM)
10138	class	Winged Helix-Turn-Helix
10138	comment	Data is from Uniprobe database
10138	family	Forkhead
10138	medline	19443739
10138	pazar_tf_id	
10138	tax_group	vertebrates
10138	type	universal protein binding microarray (PBM)
10139	class	Winged Helix-Turn-Helix
10139	comment	Data is from Uniprobe database
10139	family	Forkhead
10139	medline	19443739
10139	pazar_tf_id	
10139	tax_group	vertebrates
10139	type	universal protein binding microarray (PBM)
10140	class	Winged Helix-Turn-Helix
10140	comment	Data is from Uniprobe database
10140	family	Forkhead
10140	medline	19443739
10140	pazar_tf_id	
10140	tax_group	vertebrates
10140	type	universal protein binding microarray (PBM)
10141	class	Winged Helix-Turn-Helix
10141	comment	Data is from Uniprobe database
10141	family	Forkhead
10141	medline	19443739
10141	pazar_tf_id	
10141	tax_group	vertebrates
10141	type	universal protein binding microarray (PBM)
10142	class	Winged Helix-Turn-Helix
10142	comment	Data is from Uniprobe database
10142	family	Ets
10142	medline	19443739
10142	pazar_tf_id	
10142	tax_group	vertebrates
10142	type	universal protein binding microarray (PBM)
10143	class	Zinc-coordinating
10143	comment	Data is from Uniprobe database
10143	family	GATA
10143	medline	19443739
10143	pazar_tf_id	
10143	tax_group	vertebrates
10143	type	universal protein binding microarray (PBM)
10144	class	Zinc-coordinating
10144	comment	Data is from Uniprobe database
10144	family	GATA
10144	medline	19443739
10144	pazar_tf_id	
10144	tax_group	vertebrates
10144	type	universal protein binding microarray (PBM)
10145	class	Zinc-coordinating
10145	comment	Data is from Uniprobe database
10145	family	GATA
10145	medline	19443739
10145	pazar_tf_id	
10145	tax_group	vertebrates
10145	type	universal protein binding microarray (PBM)
10146	class	Zinc-coordinating
10146	comment	Data is from Uniprobe database
10146	family	Glial Cells Missing (GCM)
10146	medline	19443739
10146	pazar_tf_id	
10146	tax_group	vertebrates
10146	type	universal protein binding microarray (PBM)
10147	class	Zinc-coordinating
10147	comment	Data is from Uniprobe database
10147	family	BetaBetaAlpha-zinc finger
10147	medline	19443739
10147	pazar_tf_id	
10147	tax_group	vertebrates
10147	type	universal protein binding microarray (PBM)
10148	class	Zinc-coordinating
10148	comment	Data is from Uniprobe database
10148	family	BetaBetaAlpha-zinc finger
10148	medline	19443739
10148	pazar_tf_id	
10148	tax_group	vertebrates
10148	type	universal protein binding microarray (PBM)
10149	class	Other Alpha-Helix
10149	comment	Data is from Uniprobe database
10149	family	Sand
10149	medline	19443739
10149	pazar_tf_id	
10149	tax_group	vertebrates
10149	type	universal protein binding microarray (PBM)
10150	class	Other Alpha-Helix
10150	comment	Data is from Uniprobe database
10150	family	High Mobility Group box (HMG)
10150	medline	19443739
10150	pazar_tf_id	
10150	tax_group	vertebrates
10150	type	universal protein binding microarray (PBM)
10151	class	Zinc-coordinating
10151	comment	Data is from Uniprobe database
10151	family	BetaBetaAlpha-zinc finger
10151	medline	19443739
10151	pazar_tf_id	
10151	tax_group	vertebrates
10151	type	universal protein binding microarray (PBM)
10152	class	Zinc-coordinating
10152	comment	Data is from Uniprobe database
10152	family	Hormone-nuclear Receptor
10152	medline	19443739
10152	pazar_tf_id	
10152	tax_group	vertebrates
10152	type	universal protein binding microarray (PBM)
10153	class	Helix-Turn-Helix
10153	comment	Data is from Uniprobe database
10153	family	Homeo
10153	medline	19443739
10153	pazar_tf_id	
10153	tax_group	vertebrates
10153	type	universal protein binding microarray (PBM)
10154	class	-
10154	comment	Data is from Uniprobe database
10154	family	-
10154	medline	19443739
10154	pazar_tf_id	
10154	tax_group	vertebrates
10154	type	universal protein binding microarray (PBM)
10155	class	Winged Helix-Turn-Helix
10155	comment	Data is from Uniprobe database
10155	family	IRF
10155	medline	19443739
10155	pazar_tf_id	
10155	tax_group	vertebrates
10155	type	universal protein binding microarray (PBM)
10156	class	Winged Helix-Turn-Helix
10156	comment	Data is from Uniprobe database
10156	family	IRF
10156	medline	19443739
10156	pazar_tf_id	
10156	tax_group	vertebrates
10156	type	universal protein binding microarray (PBM)
10157	class	Winged Helix-Turn-Helix
10157	comment	Data is from Uniprobe database
10157	family	IRF
10157	medline	19443739
10157	pazar_tf_id	
10157	tax_group	vertebrates
10157	type	universal protein binding microarray (PBM)
10158	class	Winged Helix-Turn-Helix
10158	comment	Data is from Uniprobe database
10158	family	IRF
10158	medline	19443739
10158	pazar_tf_id	
10158	tax_group	vertebrates
10158	type	universal protein binding microarray (PBM)
10159	class	Winged Helix-Turn-Helix
10159	comment	Data is from Uniprobe database
10159	family	IRF
10159	medline	19443739
10159	pazar_tf_id	
10159	tax_group	vertebrates
10159	type	universal protein binding microarray (PBM)
10160	class	Zipper-Type
10160	comment	Data is from Uniprobe database
10160	family	Leucine Zipper
10160	medline	19443739
10160	pazar_tf_id	
10160	tax_group	vertebrates
10160	type	universal protein binding microarray (PBM)
10161	class	Zinc-coordinating
10161	comment	Data is from Uniprobe database
10161	family	BetaBetaAlpha-zinc finger
10161	medline	19443739
10161	pazar_tf_id	
10161	tax_group	vertebrates
10161	type	universal protein binding microarray (PBM)
10162	class	Other Alpha-Helix
10162	comment	Data is from Uniprobe database
10162	family	High Mobility Group box (HMG)
10162	medline	19443739
10162	pazar_tf_id	
10162	tax_group	vertebrates
10162	type	universal protein binding microarray (PBM)
10163	class	Zipper-Type
10163	comment	Data is from Uniprobe database
10163	family	Leucine Zipper
10163	medline	19443739
10163	pazar_tf_id	
10163	tax_group	vertebrates
10163	type	universal protein binding microarray (PBM)
10164	class	Zipper-Type
10164	comment	Data is from Uniprobe database
10164	family	Leucine Zipper
10164	medline	19443739
10164	pazar_tf_id	
10164	tax_group	vertebrates
10164	type	universal protein binding microarray (PBM)
10165	class	Zipper-Type
10165	comment	Data is from Uniprobe database
10165	family	Helix-Loop-Helix
10165	medline	19443739
10165	pazar_tf_id	
10165	tax_group	vertebrates
10165	type	universal protein binding microarray (PBM)
10166	class	Zinc-coordinating
10166	comment	Data is from Uniprobe database
10166	family	BetaBetaAlpha-zinc finger
10166	medline	19443739
10166	pazar_tf_id	
10166	tax_group	vertebrates
10166	type	universal protein binding microarray (PBM)
10167	class	Helix-Turn-Helix
10167	comment	Data is from Uniprobe database
10167	family	Myb
10167	medline	19443739
10167	pazar_tf_id	
10167	tax_group	vertebrates
10167	type	universal protein binding microarray (PBM)
10168	class	Helix-Turn-Helix
10168	comment	Data is from Uniprobe database
10168	family	Myb
10168	medline	19443739
10168	pazar_tf_id	
10168	tax_group	vertebrates
10168	type	universal protein binding microarray (PBM)
10169	class	Zipper-Type
10169	comment	Data is from Uniprobe database
10169	family	Helix-Loop-Helix
10169	medline	19443739
10169	pazar_tf_id	
10169	tax_group	vertebrates
10169	type	universal protein binding microarray (PBM)
10170	class	Helix-Turn-Helix
10170	comment	Data is from Uniprobe database
10170	family	Homeo
10170	medline	19443739
10170	pazar_tf_id	
10170	tax_group	vertebrates
10170	type	universal protein binding microarray (PBM)
10171	class	Zinc-coordinating
10171	comment	Data is from Uniprobe database
10171	family	Hormone-nuclear Receptor
10171	medline	19443739
10171	pazar_tf_id	
10171	tax_group	vertebrates
10171	type	universal protein binding microarray (PBM)
10172	class	Zinc-coordinating
10172	comment	Data is from Uniprobe database
10172	family	BetaBetaAlpha-zinc finger
10172	medline	19443739
10172	pazar_tf_id	
10172	tax_group	vertebrates
10172	type	universal protein binding microarray (PBM)
10173	class	Zinc-coordinating
10173	comment	Data is from Uniprobe database
10173	family	BetaBetaAlpha-zinc finger
10173	medline	19443739
10173	pazar_tf_id	
10173	tax_group	vertebrates
10173	type	universal protein binding microarray (PBM)
10174	class	Zinc-coordinating
10174	comment	Data is from Uniprobe database
10174	family	BetaBetaAlpha-zinc finger
10174	medline	19443739
10174	pazar_tf_id	
10174	tax_group	vertebrates
10174	type	universal protein binding microarray (PBM)
10175	class	Zinc-coordinating
10175	comment	Data is from Uniprobe database
10175	family	Hormone-nuclear Receptor
10175	medline	19443739
10175	pazar_tf_id	
10175	tax_group	vertebrates
10175	type	universal protein binding microarray (PBM)
10176	class	Winged Helix-Turn-Helix
10176	comment	Data is from Uniprobe database
10176	family	RFX
10176	medline	19443739
10176	pazar_tf_id	
10176	tax_group	vertebrates
10176	type	universal protein binding microarray (PBM)
10177	class	Winged Helix-Turn-Helix
10177	comment	Data is from Uniprobe database
10177	family	RFX
10177	medline	19443739
10177	pazar_tf_id	
10177	tax_group	vertebrates
10177	type	universal protein binding microarray (PBM)
10178	class	Winged Helix-Turn-Helix
10178	comment	Data is from Uniprobe database
10178	family	RFX
10178	medline	19443739
10178	pazar_tf_id	
10178	tax_group	vertebrates
10178	type	universal protein binding microarray (PBM)
10179	class	Zinc-coordinating
10179	comment	Data is from Uniprobe database
10179	family	Hormone-nuclear Receptor
10179	medline	19443739
10179	pazar_tf_id	
10179	tax_group	vertebrates
10179	type	universal protein binding microarray (PBM)
10180	class	Winged Helix-Turn-Helix
10180	comment	Data is from Uniprobe database
10180	family	Ets
10180	medline	19443739
10180	pazar_tf_id	
10180	tax_group	vertebrates
10180	type	universal protein binding microarray (PBM)
10181	class	Helix-Turn-Helix
10181	comment	Data is from Uniprobe database
10181	family	Homeo
10181	medline	19443739
10181	pazar_tf_id	
10181	tax_group	vertebrates
10181	type	universal protein binding microarray (PBM)
10182	class	Zinc-coordinating
10182	comment	Data is from Uniprobe database
10182	family	MH1
10182	medline	19443739
10182	pazar_tf_id	
10182	tax_group	vertebrates
10182	type	universal protein binding microarray (PBM)
10183	class	Other Alpha-Helix
10183	comment	Data is from Uniprobe database
10183	family	High Mobility Group box (HMG)
10183	medline	19443739
10183	pazar_tf_id	
10183	tax_group	vertebrates
10183	type	universal protein binding microarray (PBM)
10184	class	Other Alpha-Helix
10184	comment	Data is from Uniprobe database
10184	family	High Mobility Group box (HMG)
10184	medline	19443739
10184	pazar_tf_id	
10184	tax_group	vertebrates
10184	type	universal protein binding microarray (PBM)
10185	class	Other Alpha-Helix
10185	comment	Data is from Uniprobe database
10185	family	High Mobility Group box (HMG)
10185	medline	19443739
10185	pazar_tf_id	
10185	tax_group	vertebrates
10185	type	universal protein binding microarray (PBM)
10186	class	Other Alpha-Helix
10186	comment	Data is from Uniprobe database
10186	family	High Mobility Group box (HMG)
10186	medline	19443739
10186	pazar_tf_id	
10186	tax_group	vertebrates
10186	type	universal protein binding microarray (PBM)
10187	class	Other Alpha-Helix
10187	comment	Data is from Uniprobe database
10187	family	High Mobility Group box (HMG)
10187	medline	19443739
10187	pazar_tf_id	
10187	tax_group	vertebrates
10187	type	universal protein binding microarray (PBM)
10188	class	Other Alpha-Helix
10188	comment	Data is from Uniprobe database
10188	family	High Mobility Group box (HMG)
10188	medline	19443739
10188	pazar_tf_id	
10188	tax_group	vertebrates
10188	type	universal protein binding microarray (PBM)
10189	class	Other Alpha-Helix
10189	comment	Data is from Uniprobe database
10189	family	High Mobility Group box (HMG)
10189	medline	19443739
10189	pazar_tf_id	
10189	tax_group	vertebrates
10189	type	universal protein binding microarray (PBM)
10190	class	Other Alpha-Helix
10190	comment	Data is from Uniprobe database
10190	family	High Mobility Group box (HMG)
10190	medline	19443739
10190	pazar_tf_id	
10190	tax_group	vertebrates
10190	type	universal protein binding microarray (PBM)
10191	class	Other Alpha-Helix
10191	comment	Data is from Uniprobe database
10191	family	High Mobility Group box (HMG)
10191	medline	19443739
10191	pazar_tf_id	
10191	tax_group	vertebrates
10191	type	universal protein binding microarray (PBM)
10192	class	Other Alpha-Helix
10192	comment	Data is from Uniprobe database
10192	family	High Mobility Group box (HMG)
10192	medline	19443739
10192	pazar_tf_id	
10192	tax_group	vertebrates
10192	type	universal protein binding microarray (PBM)
10193	class	Other Alpha-Helix
10193	comment	Data is from Uniprobe database
10193	family	High Mobility Group box (HMG)
10193	medline	19443739
10193	pazar_tf_id	
10193	tax_group	vertebrates
10193	type	universal protein binding microarray (PBM)
10194	class	Other Alpha-Helix
10194	comment	Data is from Uniprobe database
10194	family	High Mobility Group box (HMG)
10194	medline	19443739
10194	pazar_tf_id	
10194	tax_group	vertebrates
10194	type	universal protein binding microarray (PBM)
10195	class	Other Alpha-Helix
10195	comment	Data is from Uniprobe database
10195	family	High Mobility Group box (HMG)
10195	medline	19443739
10195	pazar_tf_id	
10195	tax_group	vertebrates
10195	type	universal protein binding microarray (PBM)
10196	class	Other Alpha-Helix
10196	comment	Data is from Uniprobe database
10196	family	High Mobility Group box (HMG)
10196	medline	19443739
10196	pazar_tf_id	
10196	tax_group	vertebrates
10196	type	universal protein binding microarray (PBM)
10197	class	Other Alpha-Helix
10197	comment	Data is from Uniprobe database
10197	family	Sand
10197	medline	19443739
10197	pazar_tf_id	
10197	tax_group	vertebrates
10197	type	universal protein binding microarray (PBM)
10198	class	Zinc-coordinating
10198	comment	Data is from Uniprobe database
10198	family	BetaBetaAlpha-zinc finger
10198	medline	19443739
10198	pazar_tf_id	
10198	tax_group	vertebrates
10198	type	universal protein binding microarray (PBM)
10199	class	Winged Helix-Turn-Helix
10199	comment	Data is from Uniprobe database
10199	family	Ets
10199	medline	19443739
10199	pazar_tf_id	
10199	tax_group	vertebrates
10199	type	universal protein binding microarray (PBM)
10200	class	Other Alpha-Helix
10200	comment	Data is from Uniprobe database
10200	family	MADS
10200	medline	19443739
10200	pazar_tf_id	
10200	tax_group	vertebrates
10200	type	universal protein binding microarray (PBM)
10201	class	Other Alpha-Helix
10201	comment	Data is from Uniprobe database
10201	family	High Mobility Group box (HMG)
10201	medline	19443739
10201	pazar_tf_id	
10201	tax_group	vertebrates
10201	type	universal protein binding microarray (PBM)
10202	class	Beta-sheet
10202	comment	Data is from Uniprobe database
10202	family	TATA-binding
10202	medline	19443739
10202	pazar_tf_id	
10202	tax_group	vertebrates
10202	type	universal protein binding microarray (PBM)
10203	class	Helix-Turn-Helix
10203	comment	Data is from Uniprobe database
10203	family	Homeo
10203	medline	19443739
10203	pazar_tf_id	
10203	tax_group	vertebrates
10203	type	universal protein binding microarray (PBM)
10204	class	Other Alpha-Helix
10204	comment	Data is from Uniprobe database
10204	family	High Mobility Group box (HMG)
10204	medline	19443739
10204	pazar_tf_id	
10204	tax_group	vertebrates
10204	type	universal protein binding microarray (PBM)
10205	class	Other Alpha-Helix
10205	comment	Data is from Uniprobe database
10205	family	High Mobility Group box (HMG)
10205	medline	19443739
10205	pazar_tf_id	
10205	tax_group	vertebrates
10205	type	universal protein binding microarray (PBM)
10206	class	Other Alpha-Helix
10206	comment	Data is from Uniprobe database
10206	family	High Mobility Group box (HMG)
10206	medline	19443739
10206	pazar_tf_id	
10206	tax_group	vertebrates
10206	type	universal protein binding microarray (PBM)
10207	class	Zipper-Type
10207	comment	Data is from Uniprobe database
10207	family	Helix-Loop-Helix
10207	medline	19443739
10207	pazar_tf_id	
10207	tax_group	vertebrates
10207	type	universal protein binding microarray (PBM)
10208	class	Zipper-Type
10208	comment	Data is from Uniprobe database
10208	family	Helix-Loop-Helix
10208	medline	19443739
10208	pazar_tf_id	
10208	tax_group	vertebrates
10208	type	universal protein binding microarray (PBM)
10209	class	Zipper-Type
10209	comment	Data is from Uniprobe database
10209	family	Helix-Loop-Helix
10209	medline	19443739
10209	pazar_tf_id	
10209	tax_group	vertebrates
10209	type	universal protein binding microarray (PBM)
10210	class	Zipper-Type
10210	comment	Data is from Uniprobe database
10210	family	Helix-Loop-Helix
10210	medline	19443739
10210	pazar_tf_id	
10210	tax_group	vertebrates
10210	type	universal protein binding microarray (PBM)
10211	class	Zipper-Type
10211	comment	Data is from Uniprobe database
10211	family	Helix-Loop-Helix
10211	medline	19443739
10211	pazar_tf_id	
10211	tax_group	vertebrates
10211	type	universal protein binding microarray (PBM)
10212	class	Zinc-coordinating
10212	comment	Data is from Uniprobe database
10212	family	BetaBetaAlpha-zinc finger
10212	medline	19443739
10212	pazar_tf_id	
10212	tax_group	vertebrates
10212	type	universal protein binding microarray (PBM)
10213	class	Zinc-coordinating
10213	comment	Data is from Uniprobe database
10213	family	BetaBetaAlpha-zinc finger
10213	medline	19443739
10213	pazar_tf_id	
10213	tax_group	vertebrates
10213	type	universal protein binding microarray (PBM)
10214	class	Zinc-coordinating
10214	comment	Data is from Uniprobe database
10214	family	BetaBetaAlpha-zinc finger
10214	medline	19443739
10214	pazar_tf_id	
10214	tax_group	vertebrates
10214	type	universal protein binding microarray (PBM)
10215	class	Zinc-coordinating
10215	comment	Data is from Uniprobe database
10215	family	BetaBetaAlpha-zinc finger
10215	medline	19443739
10215	pazar_tf_id	
10215	tax_group	vertebrates
10215	type	universal protein binding microarray (PBM)
10216	class	Zinc-coordinating
10216	comment	Data is from Uniprobe database
10216	family	BetaBetaAlpha-zinc finger
10216	medline	19443739
10216	pazar_tf_id	
10216	tax_group	vertebrates
10216	type	universal protein binding microarray (PBM)
10217	class	Zinc-coordinating
10217	comment	Data is from Uniprobe database
10217	family	BetaBetaAlpha-zinc finger
10217	medline	19443739
10217	pazar_tf_id	
10217	tax_group	vertebrates
10217	type	universal protein binding microarray (PBM)
10218	class	Zinc-coordinating
10218	comment	Data is from Uniprobe database
10218	family	BetaBetaAlpha-zinc finger
10218	medline	19443739
10218	pazar_tf_id	
10218	tax_group	vertebrates
10218	type	universal protein binding microarray (PBM)
10219	class	Zinc-coordinating
10219	comment	Data is from Uniprobe database
10219	family	BetaBetaAlpha-zinc finger
10219	medline	19443739
10219	pazar_tf_id	
10219	tax_group	vertebrates
10219	type	universal protein binding microarray (PBM)
10220	class	Zinc-coordinating
10220	comment	Data is from Uniprobe database
10220	family	BetaBetaAlpha-zinc finger
10220	medline	19443739
10220	pazar_tf_id	
10220	tax_group	vertebrates
10220	type	universal protein binding microarray (PBM)
10221	class	Zinc-coordinating
10221	comment	Data is from Uniprobe database
10221	family	BetaBetaAlpha-zinc finger
10221	medline	19443739
10221	pazar_tf_id	
10221	tax_group	vertebrates
10221	type	universal protein binding microarray (PBM)
10222	class	Zinc-coordinating
10222	comment	Data is from Uniprobe database
10222	family	BetaBetaAlpha-zinc finger
10222	medline	19443739
10222	pazar_tf_id	
10222	tax_group	vertebrates
10222	type	universal protein binding microarray (PBM)
10223	class	Zinc-coordinating
10223	comment	Data is from Uniprobe database
10223	family	BetaBetaAlpha-zinc finger
10223	medline	19443739
10223	pazar_tf_id	
10223	tax_group	vertebrates
10223	type	universal protein binding microarray (PBM)
10224	class	Zinc-coordinating
10224	comment	Data is from Uniprobe database
10224	family	BetaBetaAlpha-zinc finger
10224	medline	19443739
10224	pazar_tf_id	
10224	tax_group	vertebrates
10224	type	universal protein binding microarray (PBM)
10225	class	Zinc-coordinating
10225	comment	Data is from Uniprobe database
10225	family	BetaBetaAlpha-zinc finger
10225	medline	19443739
10225	pazar_tf_id	
10225	tax_group	vertebrates
10225	type	universal protein binding microarray (PBM)
10226	class	Zinc-coordinating
10226	comment	Data is from Uniprobe database
10226	family	BetaBetaAlpha-zinc finger
10226	medline	19443739
10226	pazar_tf_id	
10226	tax_group	vertebrates
10226	type	universal protein binding microarray (PBM)
10227	class	Helix-Turn-Helix
10227	comment	Data is from Uniprobe database
10227	family	Arid
10227	medline	19443739
10227	pazar_tf_id	
10227	tax_group	vertebrates
10227	type	universal protein binding microarray (PBM)
10228	class	Helix-Turn-Helix
10228	comment	Data is from Uniprobe database
10228	family	Arid
10228	medline	19443739
10228	pazar_tf_id	
10228	tax_group	vertebrates
10228	type	universal protein binding microarray (PBM)
10229	class	Zipper-Type
10229	comment	Data is from Uniprobe database
10229	family	Helix-Loop-Helix
10229	medline	19443739
10229	pazar_tf_id	
10229	tax_group	vertebrates
10229	type	universal protein binding microarray (PBM)
10230	class	Zipper-Type
10230	comment	Data is from Uniprobe database
10230	family	Leucine Zipper
10230	medline	19443739
10230	pazar_tf_id	
10230	tax_group	vertebrates
10230	type	universal protein binding microarray (PBM)
10231	class	Other Alpha-Helix
10231	comment	Data is from Uniprobe database
10231	family	High Mobility Group box (HMG)
10231	medline	19443739
10231	pazar_tf_id	
10231	tax_group	vertebrates
10231	type	universal protein binding microarray (PBM)
10232	class	Zinc-coordinating
10232	comment	Data is from Uniprobe database
10232	family	BetaBetaAlpha-zinc finger
10232	medline	19443739
10232	pazar_tf_id	
10232	tax_group	vertebrates
10232	type	universal protein binding microarray (PBM)
10233	class	Zipper-Type
10233	comment	Data is from Uniprobe database
10233	family	Helix-Loop-Helix
10233	medline	19443739
10233	pazar_tf_id	
10233	tax_group	vertebrates
10233	type	universal protein binding microarray (PBM)
10234	class	Winged Helix-Turn-Helix
10234	comment	Data is from Uniprobe database
10234	family	E2F
10234	medline	19443739
10234	pazar_tf_id	
10234	tax_group	vertebrates
10234	type	universal protein binding microarray (PBM)
10235	class	Winged Helix-Turn-Helix
10235	comment	Data is from Uniprobe database
10235	family	E2F
10235	medline	19443739
10235	pazar_tf_id	
10235	tax_group	vertebrates
10235	type	universal protein binding microarray (PBM)
10236	class	Zinc-coordinating
10236	comment	Data is from Uniprobe database
10236	family	BetaBetaAlpha-zinc finger
10236	medline	19443739
10236	pazar_tf_id	
10236	tax_group	vertebrates
10236	type	universal protein binding microarray (PBM)
10237	class	Winged Helix-Turn-Helix
10237	comment	Data is from Uniprobe database
10237	family	Ets
10237	medline	19443739
10237	pazar_tf_id	
10237	tax_group	vertebrates
10237	type	universal protein binding microarray (PBM)
10238	class	Winged Helix-Turn-Helix
10238	comment	Data is from Uniprobe database
10238	family	Ets
10238	medline	19443739
10238	pazar_tf_id	
10238	tax_group	vertebrates
10238	type	universal protein binding microarray (PBM)
10239	class	Beta-Hairpin-Ribbon
10239	comment	Data is from Uniprobe database
10239	family	E2F T
10239	medline	19443739
10239	pazar_tf_id	
10239	tax_group	vertebrates
10239	type	universal protein binding microarray (PBM)
10240	class	Zinc-coordinating
10240	comment	Data is from Uniprobe database
10240	family	Hormone-nuclear Receptor
10240	medline	19443739
10240	pazar_tf_id	
10240	tax_group	vertebrates
10240	type	universal protein binding microarray (PBM)
10241	class	Winged Helix-Turn-Helix
10241	comment	Data is from Uniprobe database
10241	family	Forkhead
10241	medline	19443739
10241	pazar_tf_id	
10241	tax_group	vertebrates
10241	type	universal protein binding microarray (PBM)
10242	class	Winged Helix-Turn-Helix
10242	comment	Data is from Uniprobe database
10242	family	Forkhead
10242	medline	19443739
10242	pazar_tf_id	
10242	tax_group	vertebrates
10242	type	universal protein binding microarray (PBM)
10243	class	Winged Helix-Turn-Helix
10243	comment	Data is from Uniprobe database
10243	family	Forkhead
10243	medline	19443739
10243	pazar_tf_id	
10243	tax_group	vertebrates
10243	type	universal protein binding microarray (PBM)
10244	class	Winged Helix-Turn-Helix
10244	comment	Data is from Uniprobe database
10244	family	Forkhead
10244	medline	19443739
10244	pazar_tf_id	
10244	tax_group	vertebrates
10244	type	universal protein binding microarray (PBM)
10245	class	Winged Helix-Turn-Helix
10245	comment	Data is from Uniprobe database
10245	family	Forkhead
10245	medline	19443739
10245	pazar_tf_id	
10245	tax_group	vertebrates
10245	type	universal protein binding microarray (PBM)
10246	class	Winged Helix-Turn-Helix
10246	comment	Data is from Uniprobe database
10246	family	Ets
10246	medline	19443739
10246	pazar_tf_id	
10246	tax_group	vertebrates
10246	type	universal protein binding microarray (PBM)
10247	class	Zinc-coordinating
10247	comment	Data is from Uniprobe database
10247	family	GATA
10247	medline	19443739
10247	pazar_tf_id	
10247	tax_group	vertebrates
10247	type	universal protein binding microarray (PBM)
10248	class	Zinc-coordinating
10248	comment	Data is from Uniprobe database
10248	family	GATA
10248	medline	19443739
10248	pazar_tf_id	
10248	tax_group	vertebrates
10248	type	universal protein binding microarray (PBM)
10249	class	Zinc-coordinating
10249	comment	Data is from Uniprobe database
10249	family	GATA
10249	medline	19443739
10249	pazar_tf_id	
10249	tax_group	vertebrates
10249	type	universal protein binding microarray (PBM)
10250	class	Zinc-coordinating
10250	comment	Data is from Uniprobe database
10250	family	Glial Cells Missing (GCM)
10250	medline	19443739
10250	pazar_tf_id	
10250	tax_group	vertebrates
10250	type	universal protein binding microarray (PBM)
10251	class	Zinc-coordinating
10251	comment	Data is from Uniprobe database
10251	family	BetaBetaAlpha-zinc finger
10251	medline	19443739
10251	pazar_tf_id	
10251	tax_group	vertebrates
10251	type	universal protein binding microarray (PBM)
10252	class	Zinc-coordinating
10252	comment	Data is from Uniprobe database
10252	family	BetaBetaAlpha-zinc finger
10252	medline	19443739
10252	pazar_tf_id	
10252	tax_group	vertebrates
10252	type	universal protein binding microarray (PBM)
10253	class	Other Alpha-Helix
10253	comment	Data is from Uniprobe database
10253	family	Sand
10253	medline	19443739
10253	pazar_tf_id	
10253	tax_group	vertebrates
10253	type	universal protein binding microarray (PBM)
10254	class	Other Alpha-Helix
10254	comment	Data is from Uniprobe database
10254	family	High Mobility Group box (HMG)
10254	medline	19443739
10254	pazar_tf_id	
10254	tax_group	vertebrates
10254	type	universal protein binding microarray (PBM)
10255	class	Zinc-coordinating
10255	comment	Data is from Uniprobe database
10255	family	BetaBetaAlpha-zinc finger
10255	medline	19443739
10255	pazar_tf_id	
10255	tax_group	vertebrates
10255	type	universal protein binding microarray (PBM)
10256	class	Zinc-coordinating
10256	comment	Data is from Uniprobe database
10256	family	Hormone-nuclear Receptor
10256	medline	19443739
10256	pazar_tf_id	
10256	tax_group	vertebrates
10256	type	universal protein binding microarray (PBM)
10257	class	Helix-Turn-Helix
10257	comment	Data is from Uniprobe database
10257	family	Homeo
10257	medline	19443739
10257	pazar_tf_id	
10257	tax_group	vertebrates
10257	type	universal protein binding microarray (PBM)
10258	class	-
10258	comment	Data is from Uniprobe database
10258	family	-
10258	medline	19443739
10258	pazar_tf_id	
10258	tax_group	vertebrates
10258	type	universal protein binding microarray (PBM)
10259	class	Winged Helix-Turn-Helix
10259	comment	Data is from Uniprobe database
10259	family	IRF
10259	medline	19443739
10259	pazar_tf_id	
10259	tax_group	vertebrates
10259	type	universal protein binding microarray (PBM)
10260	class	Winged Helix-Turn-Helix
10260	comment	Data is from Uniprobe database
10260	family	IRF
10260	medline	19443739
10260	pazar_tf_id	
10260	tax_group	vertebrates
10260	type	universal protein binding microarray (PBM)
10261	class	Winged Helix-Turn-Helix
10261	comment	Data is from Uniprobe database
10261	family	IRF
10261	medline	19443739
10261	pazar_tf_id	
10261	tax_group	vertebrates
10261	type	universal protein binding microarray (PBM)
10262	class	Winged Helix-Turn-Helix
10262	comment	Data is from Uniprobe database
10262	family	IRF
10262	medline	19443739
10262	pazar_tf_id	
10262	tax_group	vertebrates
10262	type	universal protein binding microarray (PBM)
10263	class	Winged Helix-Turn-Helix
10263	comment	Data is from Uniprobe database
10263	family	IRF
10263	medline	19443739
10263	pazar_tf_id	
10263	tax_group	vertebrates
10263	type	universal protein binding microarray (PBM)
10264	class	Zipper-Type
10264	comment	Data is from Uniprobe database
10264	family	Leucine Zipper
10264	medline	19443739
10264	pazar_tf_id	
10264	tax_group	vertebrates
10264	type	universal protein binding microarray (PBM)
10265	class	Zinc-coordinating
10265	comment	Data is from Uniprobe database
10265	family	BetaBetaAlpha-zinc finger
10265	medline	19443739
10265	pazar_tf_id	
10265	tax_group	vertebrates
10265	type	universal protein binding microarray (PBM)
10266	class	Other Alpha-Helix
10266	comment	Data is from Uniprobe database
10266	family	High Mobility Group box (HMG)
10266	medline	19443739
10266	pazar_tf_id	
10266	tax_group	vertebrates
10266	type	universal protein binding microarray (PBM)
10267	class	Zipper-Type
10267	comment	Data is from Uniprobe database
10267	family	Leucine Zipper
10267	medline	19443739
10267	pazar_tf_id	
10267	tax_group	vertebrates
10267	type	universal protein binding microarray (PBM)
10268	class	Zipper-Type
10268	comment	Data is from Uniprobe database
10268	family	Leucine Zipper
10268	medline	19443739
10268	pazar_tf_id	
10268	tax_group	vertebrates
10268	type	universal protein binding microarray (PBM)
10269	class	Zipper-Type
10269	comment	Data is from Uniprobe database
10269	family	Helix-Loop-Helix
10269	medline	19443739
10269	pazar_tf_id	
10269	tax_group	vertebrates
10269	type	universal protein binding microarray (PBM)
10270	class	Zinc-coordinating
10270	comment	Data is from Uniprobe database
10270	family	BetaBetaAlpha-zinc finger
10270	medline	19443739
10270	pazar_tf_id	
10270	tax_group	vertebrates
10270	type	universal protein binding microarray (PBM)
10271	class	Helix-Turn-Helix
10271	comment	Data is from Uniprobe database
10271	family	Myb
10271	medline	19443739
10271	pazar_tf_id	
10271	tax_group	vertebrates
10271	type	universal protein binding microarray (PBM)
10272	class	Helix-Turn-Helix
10272	comment	Data is from Uniprobe database
10272	family	Myb
10272	medline	19443739
10272	pazar_tf_id	
10272	tax_group	vertebrates
10272	type	universal protein binding microarray (PBM)
10273	class	Zipper-Type
10273	comment	Data is from Uniprobe database
10273	family	Helix-Loop-Helix
10273	medline	19443739
10273	pazar_tf_id	
10273	tax_group	vertebrates
10273	type	universal protein binding microarray (PBM)
10274	class	Helix-Turn-Helix
10274	comment	Data is from Uniprobe database
10274	family	Homeo
10274	medline	19443739
10274	pazar_tf_id	
10274	tax_group	vertebrates
10274	type	universal protein binding microarray (PBM)
10275	class	Zinc-coordinating
10275	comment	Data is from Uniprobe database
10275	family	Hormone-nuclear Receptor
10275	medline	19443739
10275	pazar_tf_id	
10275	tax_group	vertebrates
10275	type	universal protein binding microarray (PBM)
10276	class	Zinc-coordinating
10276	comment	Data is from Uniprobe database
10276	family	BetaBetaAlpha-zinc finger
10276	medline	19443739
10276	pazar_tf_id	
10276	tax_group	vertebrates
10276	type	universal protein binding microarray (PBM)
10277	class	Zinc-coordinating
10277	comment	Data is from Uniprobe database
10277	family	BetaBetaAlpha-zinc finger
10277	medline	19443739
10277	pazar_tf_id	
10277	tax_group	vertebrates
10277	type	universal protein binding microarray (PBM)
10278	class	Zinc-coordinating
10278	comment	Data is from Uniprobe database
10278	family	BetaBetaAlpha-zinc finger
10278	medline	19443739
10278	pazar_tf_id	
10278	tax_group	vertebrates
10278	type	universal protein binding microarray (PBM)
10279	class	Zinc-coordinating
10279	comment	Data is from Uniprobe database
10279	family	Hormone-nuclear Receptor
10279	medline	19443739
10279	pazar_tf_id	
10279	tax_group	vertebrates
10279	type	universal protein binding microarray (PBM)
10280	class	Winged Helix-Turn-Helix
10280	comment	Data is from Uniprobe database
10280	family	RFX
10280	medline	19443739
10280	pazar_tf_id	
10280	tax_group	vertebrates
10280	type	universal protein binding microarray (PBM)
10281	class	Winged Helix-Turn-Helix
10281	comment	Data is from Uniprobe database
10281	family	RFX
10281	medline	19443739
10281	pazar_tf_id	
10281	tax_group	vertebrates
10281	type	universal protein binding microarray (PBM)
10282	class	Winged Helix-Turn-Helix
10282	comment	Data is from Uniprobe database
10282	family	RFX
10282	medline	19443739
10282	pazar_tf_id	
10282	tax_group	vertebrates
10282	type	universal protein binding microarray (PBM)
10283	class	Zinc-coordinating
10283	comment	Data is from Uniprobe database
10283	family	Hormone-nuclear Receptor
10283	medline	19443739
10283	pazar_tf_id	
10283	tax_group	vertebrates
10283	type	universal protein binding microarray (PBM)
10284	class	Winged Helix-Turn-Helix
10284	comment	Data is from Uniprobe database
10284	family	Ets
10284	medline	19443739
10284	pazar_tf_id	
10284	tax_group	vertebrates
10284	type	universal protein binding microarray (PBM)
10285	class	Helix-Turn-Helix
10285	comment	Data is from Uniprobe database
10285	family	Homeo
10285	medline	19443739
10285	pazar_tf_id	
10285	tax_group	vertebrates
10285	type	universal protein binding microarray (PBM)
10286	class	Zinc-coordinating
10286	comment	Data is from Uniprobe database
10286	family	MH1
10286	medline	19443739
10286	pazar_tf_id	
10286	tax_group	vertebrates
10286	type	universal protein binding microarray (PBM)
10287	class	Other Alpha-Helix
10287	comment	Data is from Uniprobe database
10287	family	High Mobility Group box (HMG)
10287	medline	19443739
10287	pazar_tf_id	
10287	tax_group	vertebrates
10287	type	universal protein binding microarray (PBM)
10288	class	Other Alpha-Helix
10288	comment	Data is from Uniprobe database
10288	family	High Mobility Group box (HMG)
10288	medline	19443739
10288	pazar_tf_id	
10288	tax_group	vertebrates
10288	type	universal protein binding microarray (PBM)
10289	class	Other Alpha-Helix
10289	comment	Data is from Uniprobe database
10289	family	High Mobility Group box (HMG)
10289	medline	19443739
10289	pazar_tf_id	
10289	tax_group	vertebrates
10289	type	universal protein binding microarray (PBM)
10290	class	Other Alpha-Helix
10290	comment	Data is from Uniprobe database
10290	family	High Mobility Group box (HMG)
10290	medline	19443739
10290	pazar_tf_id	
10290	tax_group	vertebrates
10290	type	universal protein binding microarray (PBM)
10291	class	Other Alpha-Helix
10291	comment	Data is from Uniprobe database
10291	family	High Mobility Group box (HMG)
10291	medline	19443739
10291	pazar_tf_id	
10291	tax_group	vertebrates
10291	type	universal protein binding microarray (PBM)
10292	class	Other Alpha-Helix
10292	comment	Data is from Uniprobe database
10292	family	High Mobility Group box (HMG)
10292	medline	19443739
10292	pazar_tf_id	
10292	tax_group	vertebrates
10292	type	universal protein binding microarray (PBM)
10293	class	Other Alpha-Helix
10293	comment	Data is from Uniprobe database
10293	family	High Mobility Group box (HMG)
10293	medline	19443739
10293	pazar_tf_id	
10293	tax_group	vertebrates
10293	type	universal protein binding microarray (PBM)
10294	class	Other Alpha-Helix
10294	comment	Data is from Uniprobe database
10294	family	High Mobility Group box (HMG)
10294	medline	19443739
10294	pazar_tf_id	
10294	tax_group	vertebrates
10294	type	universal protein binding microarray (PBM)
10295	class	Other Alpha-Helix
10295	comment	Data is from Uniprobe database
10295	family	High Mobility Group box (HMG)
10295	medline	19443739
10295	pazar_tf_id	
10295	tax_group	vertebrates
10295	type	universal protein binding microarray (PBM)
10296	class	Other Alpha-Helix
10296	comment	Data is from Uniprobe database
10296	family	High Mobility Group box (HMG)
10296	medline	19443739
10296	pazar_tf_id	
10296	tax_group	vertebrates
10296	type	universal protein binding microarray (PBM)
10297	class	Other Alpha-Helix
10297	comment	Data is from Uniprobe database
10297	family	High Mobility Group box (HMG)
10297	medline	19443739
10297	pazar_tf_id	
10297	tax_group	vertebrates
10297	type	universal protein binding microarray (PBM)
10298	class	Other Alpha-Helix
10298	comment	Data is from Uniprobe database
10298	family	High Mobility Group box (HMG)
10298	medline	19443739
10298	pazar_tf_id	
10298	tax_group	vertebrates
10298	type	universal protein binding microarray (PBM)
10299	class	Other Alpha-Helix
10299	comment	Data is from Uniprobe database
10299	family	High Mobility Group box (HMG)
10299	medline	19443739
10299	pazar_tf_id	
10299	tax_group	vertebrates
10299	type	universal protein binding microarray (PBM)
10300	class	Other Alpha-Helix
10300	comment	Data is from Uniprobe database
10300	family	High Mobility Group box (HMG)
10300	medline	19443739
10300	pazar_tf_id	
10300	tax_group	vertebrates
10300	type	universal protein binding microarray (PBM)
10301	class	Other Alpha-Helix
10301	comment	Data is from Uniprobe database
10301	family	Sand
10301	medline	19443739
10301	pazar_tf_id	
10301	tax_group	vertebrates
10301	type	universal protein binding microarray (PBM)
10302	class	Zinc-coordinating
10302	comment	Data is from Uniprobe database
10302	family	BetaBetaAlpha-zinc finger
10302	medline	19443739
10302	pazar_tf_id	
10302	tax_group	vertebrates
10302	type	universal protein binding microarray (PBM)
10303	class	Winged Helix-Turn-Helix
10303	comment	Data is from Uniprobe database
10303	family	Ets
10303	medline	19443739
10303	pazar_tf_id	
10303	tax_group	vertebrates
10303	type	universal protein binding microarray (PBM)
10304	class	Other Alpha-Helix
10304	comment	Data is from Uniprobe database
10304	family	MADS
10304	medline	19443739
10304	pazar_tf_id	
10304	tax_group	vertebrates
10304	type	universal protein binding microarray (PBM)
10305	class	Other Alpha-Helix
10305	comment	Data is from Uniprobe database
10305	family	High Mobility Group box (HMG)
10305	medline	19443739
10305	pazar_tf_id	
10305	tax_group	vertebrates
10305	type	universal protein binding microarray (PBM)
10306	class	Beta-sheet
10306	comment	Data is from Uniprobe database
10306	family	TATA-binding
10306	medline	19443739
10306	pazar_tf_id	
10306	tax_group	vertebrates
10306	type	universal protein binding microarray (PBM)
10307	class	Helix-Turn-Helix
10307	comment	Data is from Uniprobe database
10307	family	Homeo
10307	medline	19443739
10307	pazar_tf_id	
10307	tax_group	vertebrates
10307	type	universal protein binding microarray (PBM)
10308	class	Other Alpha-Helix
10308	comment	Data is from Uniprobe database
10308	family	High Mobility Group box (HMG)
10308	medline	19443739
10308	pazar_tf_id	
10308	tax_group	vertebrates
10308	type	universal protein binding microarray (PBM)
10309	class	Other Alpha-Helix
10309	comment	Data is from Uniprobe database
10309	family	High Mobility Group box (HMG)
10309	medline	19443739
10309	pazar_tf_id	
10309	tax_group	vertebrates
10309	type	universal protein binding microarray (PBM)
10310	class	Other Alpha-Helix
10310	comment	Data is from Uniprobe database
10310	family	High Mobility Group box (HMG)
10310	medline	19443739
10310	pazar_tf_id	
10310	tax_group	vertebrates
10310	type	universal protein binding microarray (PBM)
10311	class	Zipper-Type
10311	comment	Data is from Uniprobe database
10311	family	Helix-Loop-Helix
10311	medline	19443739
10311	pazar_tf_id	
10311	tax_group	vertebrates
10311	type	universal protein binding microarray (PBM)
10312	class	Zipper-Type
10312	comment	Data is from Uniprobe database
10312	family	Helix-Loop-Helix
10312	medline	19443739
10312	pazar_tf_id	
10312	tax_group	vertebrates
10312	type	universal protein binding microarray (PBM)
10313	class	Zipper-Type
10313	comment	Data is from Uniprobe database
10313	family	Helix-Loop-Helix
10313	medline	19443739
10313	pazar_tf_id	
10313	tax_group	vertebrates
10313	type	universal protein binding microarray (PBM)
10314	class	Zipper-Type
10314	comment	Data is from Uniprobe database
10314	family	Helix-Loop-Helix
10314	medline	19443739
10314	pazar_tf_id	
10314	tax_group	vertebrates
10314	type	universal protein binding microarray (PBM)
10315	class	Zipper-Type
10315	comment	Data is from Uniprobe database
10315	family	Helix-Loop-Helix
10315	medline	19443739
10315	pazar_tf_id	
10315	tax_group	vertebrates
10315	type	universal protein binding microarray (PBM)
10316	class	Zinc-coordinating
10316	comment	Data is from Uniprobe database
10316	family	BetaBetaAlpha-zinc finger
10316	medline	19443739
10316	pazar_tf_id	
10316	tax_group	vertebrates
10316	type	universal protein binding microarray (PBM)
10317	class	Zinc-coordinating
10317	comment	Data is from Uniprobe database
10317	family	BetaBetaAlpha-zinc finger
10317	medline	19443739
10317	pazar_tf_id	
10317	tax_group	vertebrates
10317	type	universal protein binding microarray (PBM)
10318	class	Zinc-coordinating
10318	comment	Data is from Uniprobe database
10318	family	BetaBetaAlpha-zinc finger
10318	medline	19443739
10318	pazar_tf_id	
10318	tax_group	vertebrates
10318	type	universal protein binding microarray (PBM)
10319	class	Zinc-coordinating
10319	comment	Data is from Uniprobe database
10319	family	BetaBetaAlpha-zinc finger
10319	medline	19443739
10319	pazar_tf_id	
10319	tax_group	vertebrates
10319	type	universal protein binding microarray (PBM)
10320	class	Zinc-coordinating
10320	comment	Data is from Uniprobe database
10320	family	BetaBetaAlpha-zinc finger
10320	medline	19443739
10320	pazar_tf_id	
10320	tax_group	vertebrates
10320	type	universal protein binding microarray (PBM)
10321	class	Zinc-coordinating
10321	comment	Data is from Uniprobe database
10321	family	BetaBetaAlpha-zinc finger
10321	medline	19443739
10321	pazar_tf_id	
10321	tax_group	vertebrates
10321	type	universal protein binding microarray (PBM)
10322	class	Zinc-coordinating
10322	comment	Data is from Uniprobe database
10322	family	BetaBetaAlpha-zinc finger
10322	medline	19443739
10322	pazar_tf_id	
10322	tax_group	vertebrates
10322	type	universal protein binding microarray (PBM)
10323	class	Zinc-coordinating
10323	comment	Data is from Uniprobe database
10323	family	BetaBetaAlpha-zinc finger
10323	medline	19443739
10323	pazar_tf_id	
10323	tax_group	vertebrates
10323	type	universal protein binding microarray (PBM)
10324	class	Zinc-coordinating
10324	comment	Data is from Uniprobe database
10324	family	BetaBetaAlpha-zinc finger
10324	medline	19443739
10324	pazar_tf_id	
10324	tax_group	vertebrates
10324	type	universal protein binding microarray (PBM)
10325	class	Zinc-coordinating
10325	comment	Data is from Uniprobe database
10325	family	BetaBetaAlpha-zinc finger
10325	medline	19443739
10325	pazar_tf_id	
10325	tax_group	vertebrates
10325	type	universal protein binding microarray (PBM)
10326	class	Zinc-coordinating
10326	comment	Data is from Uniprobe database
10326	family	BetaBetaAlpha-zinc finger
10326	medline	19443739
10326	pazar_tf_id	
10326	tax_group	vertebrates
10326	type	universal protein binding microarray (PBM)
10327	class	Zinc-coordinating
10327	comment	Data is from Uniprobe database
10327	family	BetaBetaAlpha-zinc finger
10327	medline	19443739
10327	pazar_tf_id	
10327	tax_group	vertebrates
10327	type	universal protein binding microarray (PBM)
10328	class	Zinc-coordinating
10328	comment	Data is from Uniprobe database
10328	family	BetaBetaAlpha-zinc finger
10328	medline	19443739
10328	pazar_tf_id	
10328	tax_group	vertebrates
10328	type	universal protein binding microarray (PBM)
10329	class	Zinc-coordinating
10329	comment	Data is from Uniprobe database
10329	family	BetaBetaAlpha-zinc finger
10329	medline	19443739
10329	pazar_tf_id	
10329	tax_group	vertebrates
10329	type	universal protein binding microarray (PBM)
10330	class	Zinc-coordinating
10330	comment	Data is from Uniprobe database
10330	family	BetaBetaAlpha-zinc finger
10330	medline	19443739
10330	pazar_tf_id	
10330	tax_group	vertebrates
10330	type	universal protein binding microarray (PBM)
10331	class	Helix-Turn-Helix
10331	comment	Data is from Uniprobe database
10331	family	Homeo
10331	medline	18585359
10331	pazar_tf_id	
10331	tax_group	vertebrates
10331	type	universal protein binding microarray (PBM)
10332	class	Helix-Turn-Helix
10332	comment	Data is from Uniprobe database
10332	family	Homeo
10332	medline	18585359
10332	pazar_tf_id	
10332	tax_group	vertebrates
10332	type	universal protein binding microarray (PBM)
10333	class	Helix-Turn-Helix
10333	comment	Data is from Uniprobe database
10333	family	Homeo
10333	medline	18585359
10333	pazar_tf_id	
10333	tax_group	vertebrates
10333	type	universal protein binding microarray (PBM)
10334	class	Helix-Turn-Helix
10334	comment	Data is from Uniprobe database
10334	family	Homeo
10334	medline	18585359
10334	pazar_tf_id	
10334	tax_group	vertebrates
10334	type	universal protein binding microarray (PBM)
10335	class	Helix-Turn-Helix
10335	comment	Data is from Uniprobe database
10335	family	Homeo
10335	medline	18585359
10335	pazar_tf_id	
10335	tax_group	vertebrates
10335	type	universal protein binding microarray (PBM)
10336	class	Helix-Turn-Helix
10336	comment	Data is from Uniprobe database
10336	family	Homeo
10336	medline	18585359
10336	pazar_tf_id	
10336	tax_group	vertebrates
10336	type	universal protein binding microarray (PBM)
10337	class	Helix-Turn-Helix
10337	comment	Data is from Uniprobe database
10337	family	Homeo
10337	medline	18585359
10337	pazar_tf_id	
10337	tax_group	vertebrates
10337	type	universal protein binding microarray (PBM)
10338	class	Helix-Turn-Helix
10338	comment	Data is from Uniprobe database
10338	family	Homeo
10338	medline	18585359
10338	pazar_tf_id	
10338	tax_group	vertebrates
10338	type	universal protein binding microarray (PBM)
10339	class	Helix-Turn-Helix
10339	comment	Data is from Uniprobe database
10339	family	Homeo
10339	medline	18585359
10339	pazar_tf_id	
10339	tax_group	vertebrates
10339	type	universal protein binding microarray (PBM)
10340	class	Helix-Turn-Helix
10340	comment	Data is from Uniprobe database
10340	family	Homeo
10340	medline	18585359
10340	pazar_tf_id	
10340	tax_group	vertebrates
10340	type	universal protein binding microarray (PBM)
10341	class	Helix-Turn-Helix
10341	comment	Data is from Uniprobe database
10341	family	Homeo
10341	medline	18585359
10341	pazar_tf_id	
10341	tax_group	vertebrates
10341	type	universal protein binding microarray (PBM)
10342	class	Helix-Turn-Helix
10342	comment	Data is from Uniprobe database
10342	family	Homeo
10342	medline	18585359
10342	pazar_tf_id	
10342	tax_group	vertebrates
10342	type	universal protein binding microarray (PBM)
10343	class	Helix-Turn-Helix
10343	comment	Data is from Uniprobe database
10343	family	Homeo
10343	medline	18585359
10343	pazar_tf_id	
10343	tax_group	vertebrates
10343	type	universal protein binding microarray (PBM)
10344	class	Helix-Turn-Helix
10344	comment	Data is from Uniprobe database
10344	family	Homeo
10344	medline	18585359
10344	pazar_tf_id	
10344	tax_group	vertebrates
10344	type	universal protein binding microarray (PBM)
10345	class	Helix-Turn-Helix
10345	comment	Data is from Uniprobe database
10345	family	Homeo
10345	medline	18585359
10345	pazar_tf_id	
10345	tax_group	vertebrates
10345	type	universal protein binding microarray (PBM)
10346	class	Helix-Turn-Helix
10346	comment	Data is from Uniprobe database
10346	family	Homeo
10346	medline	18585359
10346	pazar_tf_id	
10346	tax_group	vertebrates
10346	type	universal protein binding microarray (PBM)
10347	class	Helix-Turn-Helix
10347	comment	Data is from Uniprobe database
10347	family	Homeo
10347	medline	18585359
10347	pazar_tf_id	
10347	tax_group	vertebrates
10347	type	universal protein binding microarray (PBM)
10348	class	Helix-Turn-Helix
10348	comment	Data is from Uniprobe database
10348	family	Homeo
10348	medline	18585359
10348	pazar_tf_id	
10348	tax_group	vertebrates
10348	type	universal protein binding microarray (PBM)
10349	class	Helix-Turn-Helix
10349	comment	Data is from Uniprobe database
10349	family	Homeo
10349	medline	18585359
10349	pazar_tf_id	
10349	tax_group	vertebrates
10349	type	universal protein binding microarray (PBM)
10350	class	Helix-Turn-Helix
10350	comment	Data is from Uniprobe database
10350	family	Homeo
10350	medline	18585359
10350	pazar_tf_id	
10350	tax_group	vertebrates
10350	type	universal protein binding microarray (PBM)
10351	class	Helix-Turn-Helix
10351	comment	Data is from Uniprobe database
10351	family	Homeo
10351	medline	18585359
10351	pazar_tf_id	
10351	tax_group	vertebrates
10351	type	universal protein binding microarray (PBM)
10352	class	Helix-Turn-Helix
10352	comment	Data is from Uniprobe database
10352	family	Homeo
10352	medline	18585359
10352	pazar_tf_id	
10352	tax_group	vertebrates
10352	type	universal protein binding microarray (PBM)
10353	class	Helix-Turn-Helix
10353	comment	Data is from Uniprobe database
10353	family	Homeo
10353	medline	18585359
10353	pazar_tf_id	
10353	tax_group	vertebrates
10353	type	universal protein binding microarray (PBM)
10354	class	Helix-Turn-Helix
10354	comment	Data is from Uniprobe database
10354	family	Homeo
10354	medline	18585359
10354	pazar_tf_id	
10354	tax_group	vertebrates
10354	type	universal protein binding microarray (PBM)
10355	class	Helix-Turn-Helix
10355	comment	Data is from Uniprobe database
10355	family	Homeo
10355	medline	18585359
10355	pazar_tf_id	
10355	tax_group	vertebrates
10355	type	universal protein binding microarray (PBM)
10356	class	Helix-Turn-Helix
10356	comment	Data is from Uniprobe database
10356	family	Homeo
10356	medline	18585359
10356	pazar_tf_id	
10356	tax_group	vertebrates
10356	type	universal protein binding microarray (PBM)
10357	class	Helix-Turn-Helix
10357	comment	Data is from Uniprobe database
10357	family	Homeo
10357	medline	18585359
10357	pazar_tf_id	
10357	tax_group	vertebrates
10357	type	universal protein binding microarray (PBM)
10358	class	Helix-Turn-Helix
10358	comment	Data is from Uniprobe database
10358	family	Homeo
10358	medline	18585359
10358	pazar_tf_id	
10358	tax_group	vertebrates
10358	type	universal protein binding microarray (PBM)
10359	class	Helix-Turn-Helix
10359	comment	Data is from Uniprobe database
10359	family	Homeo
10359	medline	18585359
10359	pazar_tf_id	
10359	tax_group	vertebrates
10359	type	universal protein binding microarray (PBM)
10360	class	Helix-Turn-Helix
10360	comment	Data is from Uniprobe database
10360	family	Homeo
10360	medline	18585359
10360	pazar_tf_id	
10360	tax_group	vertebrates
10360	type	universal protein binding microarray (PBM)
10361	class	Helix-Turn-Helix
10361	comment	Data is from Uniprobe database
10361	family	Homeo
10361	medline	18585359
10361	pazar_tf_id	
10361	tax_group	vertebrates
10361	type	universal protein binding microarray (PBM)
10362	class	Helix-Turn-Helix
10362	comment	Data is from Uniprobe database
10362	family	Homeo
10362	medline	18585359
10362	pazar_tf_id	
10362	tax_group	vertebrates
10362	type	universal protein binding microarray (PBM)
10363	class	Helix-Turn-Helix
10363	comment	Data is from Uniprobe database
10363	family	Homeo
10363	medline	18585359
10363	pazar_tf_id	
10363	tax_group	vertebrates
10363	type	universal protein binding microarray (PBM)
10364	class	Helix-Turn-Helix
10364	comment	Data is from Uniprobe database
10364	family	Homeo
10364	medline	18585359
10364	pazar_tf_id	
10364	tax_group	vertebrates
10364	type	universal protein binding microarray (PBM)
10365	class	Helix-Turn-Helix
10365	comment	Data is from Uniprobe database
10365	family	Homeo
10365	medline	18585359
10365	pazar_tf_id	
10365	tax_group	vertebrates
10365	type	universal protein binding microarray (PBM)
10366	class	Helix-Turn-Helix
10366	comment	Data is from Uniprobe database
10366	family	Homeo
10366	medline	18585359
10366	pazar_tf_id	
10366	tax_group	vertebrates
10366	type	universal protein binding microarray (PBM)
10367	class	Helix-Turn-Helix
10367	comment	Data is from Uniprobe database
10367	family	Homeo
10367	medline	18585359
10367	pazar_tf_id	
10367	tax_group	vertebrates
10367	type	universal protein binding microarray (PBM)
10368	class	Helix-Turn-Helix
10368	comment	Data is from Uniprobe database
10368	family	Homeo
10368	medline	18585359
10368	pazar_tf_id	
10368	tax_group	vertebrates
10368	type	universal protein binding microarray (PBM)
10369	class	Helix-Turn-Helix
10369	comment	Data is from Uniprobe database
10369	family	Homeo
10369	medline	18585359
10369	pazar_tf_id	
10369	tax_group	vertebrates
10369	type	universal protein binding microarray (PBM)
10370	class	Helix-Turn-Helix
10370	comment	Data is from Uniprobe database
10370	family	Homeo
10370	medline	18585359
10370	pazar_tf_id	
10370	tax_group	vertebrates
10370	type	universal protein binding microarray (PBM)
10371	class	Helix-Turn-Helix
10371	comment	Data is from Uniprobe database
10371	family	Homeo
10371	medline	18585359
10371	pazar_tf_id	
10371	tax_group	vertebrates
10371	type	universal protein binding microarray (PBM)
10372	class	Helix-Turn-Helix
10372	comment	Data is from Uniprobe database
10372	family	Homeo
10372	medline	18585359
10372	pazar_tf_id	
10372	tax_group	vertebrates
10372	type	universal protein binding microarray (PBM)
10373	class	Helix-Turn-Helix
10373	comment	Data is from Uniprobe database
10373	family	Homeo
10373	medline	18585359
10373	pazar_tf_id	
10373	tax_group	vertebrates
10373	type	universal protein binding microarray (PBM)
10374	class	Helix-Turn-Helix
10374	comment	Data is from Uniprobe database
10374	family	Homeo
10374	medline	18585359
10374	pazar_tf_id	
10374	tax_group	vertebrates
10374	type	universal protein binding microarray (PBM)
10375	class	Helix-Turn-Helix
10375	comment	Data is from Uniprobe database
10375	family	Homeo
10375	medline	18585359
10375	pazar_tf_id	
10375	tax_group	vertebrates
10375	type	universal protein binding microarray (PBM)
10376	class	Helix-Turn-Helix
10376	comment	Data is from Uniprobe database
10376	family	Homeo
10376	medline	18585359
10376	pazar_tf_id	
10376	tax_group	vertebrates
10376	type	universal protein binding microarray (PBM)
10377	class	Helix-Turn-Helix
10377	comment	Data is from Uniprobe database
10377	family	Homeo
10377	medline	18585359
10377	pazar_tf_id	
10377	tax_group	vertebrates
10377	type	universal protein binding microarray (PBM)
10378	class	Helix-Turn-Helix
10378	comment	Data is from Uniprobe database
10378	family	Homeo
10378	medline	18585359
10378	pazar_tf_id	
10378	tax_group	vertebrates
10378	type	universal protein binding microarray (PBM)
10379	class	Helix-Turn-Helix
10379	comment	Data is from Uniprobe database
10379	family	Homeo
10379	medline	18585359
10379	pazar_tf_id	
10379	tax_group	vertebrates
10379	type	universal protein binding microarray (PBM)
10380	class	Helix-Turn-Helix
10380	comment	Data is from Uniprobe database
10380	family	Homeo
10380	medline	18585359
10380	pazar_tf_id	
10380	tax_group	vertebrates
10380	type	universal protein binding microarray (PBM)
10381	class	Helix-Turn-Helix
10381	comment	Data is from Uniprobe database
10381	family	Homeo
10381	medline	18585359
10381	pazar_tf_id	
10381	tax_group	vertebrates
10381	type	universal protein binding microarray (PBM)
10382	class	Helix-Turn-Helix
10382	comment	Data is from Uniprobe database
10382	family	Homeo
10382	medline	18585359
10382	pazar_tf_id	
10382	tax_group	vertebrates
10382	type	universal protein binding microarray (PBM)
10383	class	Helix-Turn-Helix
10383	comment	Data is from Uniprobe database
10383	family	Homeo
10383	medline	18585359
10383	pazar_tf_id	
10383	tax_group	vertebrates
10383	type	universal protein binding microarray (PBM)
10384	class	Helix-Turn-Helix
10384	comment	Data is from Uniprobe database
10384	family	Homeo
10384	medline	18585359
10384	pazar_tf_id	
10384	tax_group	vertebrates
10384	type	universal protein binding microarray (PBM)
10385	class	Helix-Turn-Helix
10385	comment	Data is from Uniprobe database
10385	family	Homeo
10385	medline	18585359
10385	pazar_tf_id	
10385	tax_group	vertebrates
10385	type	universal protein binding microarray (PBM)
10386	class	Helix-Turn-Helix
10386	comment	Data is from Uniprobe database
10386	family	Homeo
10386	medline	18585359
10386	pazar_tf_id	
10386	tax_group	vertebrates
10386	type	universal protein binding microarray (PBM)
10387	class	Helix-Turn-Helix
10387	comment	Data is from Uniprobe database
10387	family	Homeo
10387	medline	18585359
10387	pazar_tf_id	
10387	tax_group	vertebrates
10387	type	universal protein binding microarray (PBM)
10388	class	Helix-Turn-Helix
10388	comment	Data is from Uniprobe database
10388	family	Homeo
10388	medline	18585359
10388	pazar_tf_id	
10388	tax_group	vertebrates
10388	type	universal protein binding microarray (PBM)
10389	class	Helix-Turn-Helix
10389	comment	Data is from Uniprobe database
10389	family	Homeo
10389	medline	18585359
10389	pazar_tf_id	
10389	tax_group	vertebrates
10389	type	universal protein binding microarray (PBM)
10390	class	Helix-Turn-Helix
10390	comment	Data is from Uniprobe database
10390	family	Homeo
10390	medline	18585359
10390	pazar_tf_id	
10390	tax_group	vertebrates
10390	type	universal protein binding microarray (PBM)
10391	class	Helix-Turn-Helix
10391	comment	Data is from Uniprobe database
10391	family	Homeo
10391	medline	18585359
10391	pazar_tf_id	
10391	tax_group	vertebrates
10391	type	universal protein binding microarray (PBM)
10392	class	Helix-Turn-Helix
10392	comment	Data is from Uniprobe database
10392	family	Homeo
10392	medline	18585359
10392	pazar_tf_id	
10392	tax_group	vertebrates
10392	type	universal protein binding microarray (PBM)
10393	class	Helix-Turn-Helix
10393	comment	Data is from Uniprobe database
10393	family	Homeo
10393	medline	18585359
10393	pazar_tf_id	
10393	tax_group	vertebrates
10393	type	universal protein binding microarray (PBM)
10394	class	Helix-Turn-Helix
10394	comment	Data is from Uniprobe database
10394	family	Homeo
10394	medline	18585359
10394	pazar_tf_id	
10394	tax_group	vertebrates
10394	type	universal protein binding microarray (PBM)
10395	class	Helix-Turn-Helix
10395	comment	Data is from Uniprobe database
10395	family	Homeo
10395	medline	18585359
10395	pazar_tf_id	
10395	tax_group	vertebrates
10395	type	universal protein binding microarray (PBM)
10396	class	Helix-Turn-Helix
10396	comment	Data is from Uniprobe database
10396	family	Homeo
10396	medline	18585359
10396	pazar_tf_id	
10396	tax_group	vertebrates
10396	type	universal protein binding microarray (PBM)
10397	class	Helix-Turn-Helix
10397	comment	Data is from Uniprobe database
10397	family	Homeo
10397	medline	18585359
10397	pazar_tf_id	
10397	tax_group	vertebrates
10397	type	universal protein binding microarray (PBM)
10398	class	Helix-Turn-Helix
10398	comment	Data is from Uniprobe database
10398	family	Homeo
10398	medline	18585359
10398	pazar_tf_id	
10398	tax_group	vertebrates
10398	type	universal protein binding microarray (PBM)
10399	class	Helix-Turn-Helix
10399	comment	Data is from Uniprobe database
10399	family	Homeo
10399	medline	18585359
10399	pazar_tf_id	
10399	tax_group	vertebrates
10399	type	universal protein binding microarray (PBM)
10400	class	Helix-Turn-Helix
10400	comment	Data is from Uniprobe database
10400	family	Homeo
10400	medline	18585359
10400	pazar_tf_id	
10400	tax_group	vertebrates
10400	type	universal protein binding microarray (PBM)
10401	class	Helix-Turn-Helix
10401	comment	Data is from Uniprobe database
10401	family	Homeo
10401	medline	18585359
10401	pazar_tf_id	
10401	tax_group	vertebrates
10401	type	universal protein binding microarray (PBM)
10402	class	Helix-Turn-Helix
10402	comment	Data is from Uniprobe database
10402	family	Homeo
10402	medline	18585359
10402	pazar_tf_id	
10402	tax_group	vertebrates
10402	type	universal protein binding microarray (PBM)
10403	class	Helix-Turn-Helix
10403	comment	Data is from Uniprobe database
10403	family	Homeo
10403	medline	18585359
10403	pazar_tf_id	
10403	tax_group	vertebrates
10403	type	universal protein binding microarray (PBM)
10404	class	Helix-Turn-Helix
10404	comment	Data is from Uniprobe database
10404	family	Homeo
10404	medline	18585359
10404	pazar_tf_id	
10404	tax_group	vertebrates
10404	type	universal protein binding microarray (PBM)
10405	class	Helix-Turn-Helix
10405	comment	Data is from Uniprobe database
10405	family	Homeo
10405	medline	18585359
10405	pazar_tf_id	
10405	tax_group	vertebrates
10405	type	universal protein binding microarray (PBM)
10406	class	Helix-Turn-Helix
10406	comment	Data is from Uniprobe database
10406	family	Homeo
10406	medline	18585359
10406	pazar_tf_id	
10406	tax_group	vertebrates
10406	type	universal protein binding microarray (PBM)
10407	class	Helix-Turn-Helix
10407	comment	Data is from Uniprobe database
10407	family	Homeo
10407	medline	18585359
10407	pazar_tf_id	
10407	tax_group	vertebrates
10407	type	universal protein binding microarray (PBM)
10408	class	Helix-Turn-Helix
10408	comment	Data is from Uniprobe database
10408	family	Homeo
10408	medline	18585359
10408	pazar_tf_id	
10408	tax_group	vertebrates
10408	type	universal protein binding microarray (PBM)
10409	class	Helix-Turn-Helix
10409	comment	Data is from Uniprobe database
10409	family	Homeo
10409	medline	18585359
10409	pazar_tf_id	
10409	tax_group	vertebrates
10409	type	universal protein binding microarray (PBM)
10410	class	Helix-Turn-Helix
10410	comment	Data is from Uniprobe database
10410	family	Homeo
10410	medline	18585359
10410	pazar_tf_id	
10410	tax_group	vertebrates
10410	type	universal protein binding microarray (PBM)
10411	class	Helix-Turn-Helix
10411	comment	Data is from Uniprobe database
10411	family	Homeo
10411	medline	18585359
10411	pazar_tf_id	
10411	tax_group	vertebrates
10411	type	universal protein binding microarray (PBM)
10412	class	Helix-Turn-Helix
10412	comment	Data is from Uniprobe database
10412	family	Homeo
10412	medline	18585359
10412	pazar_tf_id	
10412	tax_group	vertebrates
10412	type	universal protein binding microarray (PBM)
10413	class	Helix-Turn-Helix
10413	comment	Data is from Uniprobe database
10413	family	Homeo
10413	medline	18585359
10413	pazar_tf_id	
10413	tax_group	vertebrates
10413	type	universal protein binding microarray (PBM)
10414	class	Helix-Turn-Helix
10414	comment	Data is from Uniprobe database
10414	family	Homeo
10414	medline	18585359
10414	pazar_tf_id	
10414	tax_group	vertebrates
10414	type	universal protein binding microarray (PBM)
10415	class	Helix-Turn-Helix
10415	comment	Data is from Uniprobe database
10415	family	Homeo
10415	medline	18585359
10415	pazar_tf_id	
10415	tax_group	vertebrates
10415	type	universal protein binding microarray (PBM)
10416	class	Helix-Turn-Helix
10416	comment	Data is from Uniprobe database
10416	family	Homeo
10416	medline	18585359
10416	pazar_tf_id	
10416	tax_group	vertebrates
10416	type	universal protein binding microarray (PBM)
10417	class	Helix-Turn-Helix
10417	comment	Data is from Uniprobe database
10417	family	Homeo
10417	medline	18585359
10417	pazar_tf_id	
10417	tax_group	vertebrates
10417	type	universal protein binding microarray (PBM)
10418	class	Helix-Turn-Helix
10418	comment	Data is from Uniprobe database
10418	family	Homeo
10418	medline	18585359
10418	pazar_tf_id	
10418	tax_group	vertebrates
10418	type	universal protein binding microarray (PBM)
10419	class	Helix-Turn-Helix
10419	comment	Data is from Uniprobe database
10419	family	Homeo
10419	medline	18585359
10419	pazar_tf_id	
10419	tax_group	vertebrates
10419	type	universal protein binding microarray (PBM)
10420	class	Helix-Turn-Helix
10420	comment	Data is from Uniprobe database
10420	family	Homeo
10420	medline	18585359
10420	pazar_tf_id	
10420	tax_group	vertebrates
10420	type	universal protein binding microarray (PBM)
10421	class	Helix-Turn-Helix
10421	comment	Data is from Uniprobe database
10421	family	Homeo
10421	medline	18585359
10421	pazar_tf_id	
10421	tax_group	vertebrates
10421	type	universal protein binding microarray (PBM)
10422	class	Helix-Turn-Helix
10422	comment	Data is from Uniprobe database
10422	family	Homeo
10422	medline	18585359
10422	pazar_tf_id	
10422	tax_group	vertebrates
10422	type	universal protein binding microarray (PBM)
10423	class	Helix-Turn-Helix
10423	comment	Data is from Uniprobe database
10423	family	Homeo
10423	medline	18585359
10423	pazar_tf_id	
10423	tax_group	vertebrates
10423	type	universal protein binding microarray (PBM)
10424	class	Helix-Turn-Helix
10424	comment	Data is from Uniprobe database
10424	family	Homeo
10424	medline	18585359
10424	pazar_tf_id	
10424	tax_group	vertebrates
10424	type	universal protein binding microarray (PBM)
10425	class	Helix-Turn-Helix
10425	comment	Data is from Uniprobe database
10425	family	Homeo
10425	medline	18585359
10425	pazar_tf_id	
10425	tax_group	vertebrates
10425	type	universal protein binding microarray (PBM)
10426	class	Helix-Turn-Helix
10426	comment	Data is from Uniprobe database
10426	family	Homeo
10426	medline	18585359
10426	pazar_tf_id	
10426	tax_group	vertebrates
10426	type	universal protein binding microarray (PBM)
10427	class	Helix-Turn-Helix
10427	comment	Data is from Uniprobe database
10427	family	Homeo
10427	medline	18585359
10427	pazar_tf_id	
10427	tax_group	vertebrates
10427	type	universal protein binding microarray (PBM)
10428	class	Helix-Turn-Helix
10428	comment	Data is from Uniprobe database
10428	family	Homeo
10428	medline	18585359
10428	pazar_tf_id	
10428	tax_group	vertebrates
10428	type	universal protein binding microarray (PBM)
10429	class	Helix-Turn-Helix
10429	comment	Data is from Uniprobe database
10429	family	Homeo
10429	medline	18585359
10429	pazar_tf_id	
10429	tax_group	vertebrates
10429	type	universal protein binding microarray (PBM)
10430	class	Helix-Turn-Helix
10430	comment	Data is from Uniprobe database
10430	family	Homeo
10430	medline	18585359
10430	pazar_tf_id	
10430	tax_group	vertebrates
10430	type	universal protein binding microarray (PBM)
10431	class	Helix-Turn-Helix
10431	comment	Data is from Uniprobe database
10431	family	Homeo
10431	medline	18585359
10431	pazar_tf_id	
10431	tax_group	vertebrates
10431	type	universal protein binding microarray (PBM)
10432	class	Helix-Turn-Helix
10432	comment	Data is from Uniprobe database
10432	family	Homeo
10432	medline	18585359
10432	pazar_tf_id	
10432	tax_group	vertebrates
10432	type	universal protein binding microarray (PBM)
10433	class	Helix-Turn-Helix
10433	comment	Data is from Uniprobe database
10433	family	Homeo
10433	medline	18585359
10433	pazar_tf_id	
10433	tax_group	vertebrates
10433	type	universal protein binding microarray (PBM)
10434	class	Helix-Turn-Helix
10434	comment	Data is from Uniprobe database
10434	family	Homeo
10434	medline	18585359
10434	pazar_tf_id	
10434	tax_group	vertebrates
10434	type	universal protein binding microarray (PBM)
10435	class	Helix-Turn-Helix
10435	comment	Data is from Uniprobe database
10435	family	Homeo
10435	medline	18585359
10435	pazar_tf_id	
10435	tax_group	vertebrates
10435	type	universal protein binding microarray (PBM)
10436	class	Helix-Turn-Helix
10436	comment	Data is from Uniprobe database
10436	family	Homeo
10436	medline	18585359
10436	pazar_tf_id	
10436	tax_group	vertebrates
10436	type	universal protein binding microarray (PBM)
10437	class	Helix-Turn-Helix
10437	comment	Data is from Uniprobe database
10437	family	Homeo
10437	medline	18585359
10437	pazar_tf_id	
10437	tax_group	vertebrates
10437	type	universal protein binding microarray (PBM)
10438	class	Helix-Turn-Helix
10438	comment	Data is from Uniprobe database
10438	family	Homeo
10438	medline	18585359
10438	pazar_tf_id	
10438	tax_group	vertebrates
10438	type	universal protein binding microarray (PBM)
10439	class	Helix-Turn-Helix
10439	comment	Data is from Uniprobe database
10439	family	Homeo
10439	medline	18585359
10439	pazar_tf_id	
10439	tax_group	vertebrates
10439	type	universal protein binding microarray (PBM)
10440	class	Helix-Turn-Helix
10440	comment	Data is from Uniprobe database
10440	family	Homeo
10440	medline	18585359
10440	pazar_tf_id	
10440	tax_group	vertebrates
10440	type	universal protein binding microarray (PBM)
10441	class	Helix-Turn-Helix
10441	comment	Data is from Uniprobe database
10441	family	Homeo
10441	medline	18585359
10441	pazar_tf_id	
10441	tax_group	vertebrates
10441	type	universal protein binding microarray (PBM)
10442	class	Helix-Turn-Helix
10442	comment	Data is from Uniprobe database
10442	family	Homeo
10442	medline	18585359
10442	pazar_tf_id	
10442	tax_group	vertebrates
10442	type	universal protein binding microarray (PBM)
10443	class	Helix-Turn-Helix
10443	comment	Data is from Uniprobe database
10443	family	Homeo
10443	medline	18585359
10443	pazar_tf_id	
10443	tax_group	vertebrates
10443	type	universal protein binding microarray (PBM)
10444	class	Helix-Turn-Helix
10444	comment	Data is from Uniprobe database
10444	family	Homeo
10444	medline	18585359
10444	pazar_tf_id	
10444	tax_group	vertebrates
10444	type	universal protein binding microarray (PBM)
10445	class	Helix-Turn-Helix
10445	comment	Data is from Uniprobe database
10445	family	Homeo
10445	medline	18585359
10445	pazar_tf_id	
10445	tax_group	vertebrates
10445	type	universal protein binding microarray (PBM)
10446	class	Helix-Turn-Helix
10446	comment	Data is from Uniprobe database
10446	family	Homeo
10446	medline	18585359
10446	pazar_tf_id	
10446	tax_group	vertebrates
10446	type	universal protein binding microarray (PBM)
10447	class	Helix-Turn-Helix
10447	comment	Data is from Uniprobe database
10447	family	Homeo
10447	medline	18585359
10447	pazar_tf_id	
10447	tax_group	vertebrates
10447	type	universal protein binding microarray (PBM)
10448	class	Helix-Turn-Helix
10448	comment	Data is from Uniprobe database
10448	family	Homeo
10448	medline	18585359
10448	pazar_tf_id	
10448	tax_group	vertebrates
10448	type	universal protein binding microarray (PBM)
10449	class	Helix-Turn-Helix
10449	comment	Data is from Uniprobe database
10449	family	Homeo
10449	medline	18585359
10449	pazar_tf_id	
10449	tax_group	vertebrates
10449	type	universal protein binding microarray (PBM)
10450	class	Helix-Turn-Helix
10450	comment	Data is from Uniprobe database
10450	family	Homeo
10450	medline	18585359
10450	pazar_tf_id	
10450	tax_group	vertebrates
10450	type	universal protein binding microarray (PBM)
10451	class	Helix-Turn-Helix
10451	comment	Data is from Uniprobe database
10451	family	Homeo
10451	medline	18585359
10451	pazar_tf_id	
10451	tax_group	vertebrates
10451	type	universal protein binding microarray (PBM)
10452	class	Helix-Turn-Helix
10452	comment	Data is from Uniprobe database
10452	family	Homeo
10452	medline	18585359
10452	pazar_tf_id	
10452	tax_group	vertebrates
10452	type	universal protein binding microarray (PBM)
10453	class	Helix-Turn-Helix
10453	comment	Data is from Uniprobe database
10453	family	Homeo
10453	medline	18585359
10453	pazar_tf_id	
10453	tax_group	vertebrates
10453	type	universal protein binding microarray (PBM)
10454	class	Helix-Turn-Helix
10454	comment	Data is from Uniprobe database
10454	family	Homeo
10454	medline	18585359
10454	pazar_tf_id	
10454	tax_group	vertebrates
10454	type	universal protein binding microarray (PBM)
10455	class	Helix-Turn-Helix
10455	comment	Data is from Uniprobe database
10455	family	Homeo
10455	medline	18585359
10455	pazar_tf_id	
10455	tax_group	vertebrates
10455	type	universal protein binding microarray (PBM)
10456	class	Helix-Turn-Helix
10456	comment	Data is from Uniprobe database
10456	family	Homeo
10456	medline	18585359
10456	pazar_tf_id	
10456	tax_group	vertebrates
10456	type	universal protein binding microarray (PBM)
10457	class	Helix-Turn-Helix
10457	comment	Data is from Uniprobe database
10457	family	Homeo
10457	medline	18585359
10457	pazar_tf_id	
10457	tax_group	vertebrates
10457	type	universal protein binding microarray (PBM)
10458	class	Helix-Turn-Helix
10458	comment	Data is from Uniprobe database
10458	family	Homeo
10458	medline	18585359
10458	pazar_tf_id	
10458	tax_group	vertebrates
10458	type	universal protein binding microarray (PBM)
10459	class	Helix-Turn-Helix
10459	comment	Data is from Uniprobe database
10459	family	Homeo
10459	medline	18585359
10459	pazar_tf_id	
10459	tax_group	vertebrates
10459	type	universal protein binding microarray (PBM)
10460	class	Helix-Turn-Helix
10460	comment	Data is from Uniprobe database
10460	family	Homeo
10460	medline	18585359
10460	pazar_tf_id	
10460	tax_group	vertebrates
10460	type	universal protein binding microarray (PBM)
10461	class	Helix-Turn-Helix
10461	comment	Data is from Uniprobe database
10461	family	Homeo
10461	medline	18585359
10461	pazar_tf_id	
10461	tax_group	vertebrates
10461	type	universal protein binding microarray (PBM)
10462	class	Helix-Turn-Helix
10462	comment	Data is from Uniprobe database
10462	family	Homeo
10462	medline	18585359
10462	pazar_tf_id	
10462	tax_group	vertebrates
10462	type	universal protein binding microarray (PBM)
10463	class	Helix-Turn-Helix
10463	comment	Data is from Uniprobe database
10463	family	Homeo
10463	medline	18585359
10463	pazar_tf_id	
10463	tax_group	vertebrates
10463	type	universal protein binding microarray (PBM)
10464	class	Helix-Turn-Helix
10464	comment	Data is from Uniprobe database
10464	family	Homeo
10464	medline	18585359
10464	pazar_tf_id	
10464	tax_group	vertebrates
10464	type	universal protein binding microarray (PBM)
10465	class	Helix-Turn-Helix
10465	comment	Data is from Uniprobe database
10465	family	Homeo
10465	medline	18585359
10465	pazar_tf_id	
10465	tax_group	vertebrates
10465	type	universal protein binding microarray (PBM)
10466	class	Helix-Turn-Helix
10466	comment	Data is from Uniprobe database
10466	family	Homeo
10466	medline	18585359
10466	pazar_tf_id	
10466	tax_group	vertebrates
10466	type	universal protein binding microarray (PBM)
10467	class	Helix-Turn-Helix
10467	comment	Data is from Uniprobe database
10467	family	Homeo
10467	medline	18585359
10467	pazar_tf_id	
10467	tax_group	vertebrates
10467	type	universal protein binding microarray (PBM)
10468	class	Helix-Turn-Helix
10468	comment	Data is from Uniprobe database
10468	family	Homeo
10468	medline	18585359
10468	pazar_tf_id	
10468	tax_group	vertebrates
10468	type	universal protein binding microarray (PBM)
10469	class	Helix-Turn-Helix
10469	comment	Data is from Uniprobe database
10469	family	Homeo
10469	medline	18585359
10469	pazar_tf_id	
10469	tax_group	vertebrates
10469	type	universal protein binding microarray (PBM)
10470	class	Helix-Turn-Helix
10470	comment	Data is from Uniprobe database
10470	family	Homeo
10470	medline	18585359
10470	pazar_tf_id	
10470	tax_group	vertebrates
10470	type	universal protein binding microarray (PBM)
10471	class	Helix-Turn-Helix
10471	comment	Data is from Uniprobe database
10471	family	Homeo
10471	medline	18585359
10471	pazar_tf_id	
10471	tax_group	vertebrates
10471	type	universal protein binding microarray (PBM)
10472	class	Helix-Turn-Helix
10472	comment	Data is from Uniprobe database
10472	family	Homeo
10472	medline	18585359
10472	pazar_tf_id	
10472	tax_group	vertebrates
10472	type	universal protein binding microarray (PBM)
10473	class	Helix-Turn-Helix
10473	comment	Data is from Uniprobe database
10473	family	Homeo
10473	medline	18585359
10473	pazar_tf_id	
10473	tax_group	vertebrates
10473	type	universal protein binding microarray (PBM)
10474	class	Helix-Turn-Helix
10474	comment	Data is from Uniprobe database
10474	family	Homeo
10474	medline	18585359
10474	pazar_tf_id	
10474	tax_group	vertebrates
10474	type	universal protein binding microarray (PBM)
10475	class	Helix-Turn-Helix
10475	comment	Data is from Uniprobe database
10475	family	Homeo
10475	medline	18585359
10475	pazar_tf_id	
10475	tax_group	vertebrates
10475	type	universal protein binding microarray (PBM)
10476	class	Helix-Turn-Helix
10476	comment	Data is from Uniprobe database
10476	family	Homeo
10476	medline	18585359
10476	pazar_tf_id	
10476	tax_group	vertebrates
10476	type	universal protein binding microarray (PBM)
10477	class	Helix-Turn-Helix
10477	comment	Data is from Uniprobe database
10477	family	Homeo
10477	medline	18585359
10477	pazar_tf_id	
10477	tax_group	vertebrates
10477	type	universal protein binding microarray (PBM)
10478	class	Helix-Turn-Helix
10478	comment	Data is from Uniprobe database
10478	family	Homeo
10478	medline	18585359
10478	pazar_tf_id	
10478	tax_group	vertebrates
10478	type	universal protein binding microarray (PBM)
10479	class	Helix-Turn-Helix
10479	comment	Data is from Uniprobe database
10479	family	Homeo
10479	medline	18585359
10479	pazar_tf_id	
10479	tax_group	vertebrates
10479	type	universal protein binding microarray (PBM)
10480	class	Helix-Turn-Helix
10480	comment	Data is from Uniprobe database
10480	family	Homeo
10480	medline	18585359
10480	pazar_tf_id	
10480	tax_group	vertebrates
10480	type	universal protein binding microarray (PBM)
10481	class	Helix-Turn-Helix
10481	comment	Data is from Uniprobe database
10481	family	Homeo
10481	medline	18585359
10481	pazar_tf_id	
10481	tax_group	vertebrates
10481	type	universal protein binding microarray (PBM)
10482	class	Helix-Turn-Helix
10482	comment	Data is from Uniprobe database
10482	family	Homeo
10482	medline	18585359
10482	pazar_tf_id	
10482	tax_group	vertebrates
10482	type	universal protein binding microarray (PBM)
10483	class	Helix-Turn-Helix
10483	comment	Data is from Uniprobe database
10483	family	Homeo
10483	medline	18585359
10483	pazar_tf_id	
10483	tax_group	vertebrates
10483	type	universal protein binding microarray (PBM)
10484	class	Helix-Turn-Helix
10484	comment	Data is from Uniprobe database
10484	family	Homeo
10484	medline	18585359
10484	pazar_tf_id	
10484	tax_group	vertebrates
10484	type	universal protein binding microarray (PBM)
10485	class	Helix-Turn-Helix
10485	comment	Data is from Uniprobe database
10485	family	Homeo
10485	medline	18585359
10485	pazar_tf_id	
10485	tax_group	vertebrates
10485	type	universal protein binding microarray (PBM)
10486	class	Helix-Turn-Helix
10486	comment	Data is from Uniprobe database
10486	family	Homeo
10486	medline	18585359
10486	pazar_tf_id	
10486	tax_group	vertebrates
10486	type	universal protein binding microarray (PBM)
10487	class	Helix-Turn-Helix
10487	comment	Data is from Uniprobe database
10487	family	Homeo
10487	medline	18585359
10487	pazar_tf_id	
10487	tax_group	vertebrates
10487	type	universal protein binding microarray (PBM)
10488	class	Helix-Turn-Helix
10488	comment	Data is from Uniprobe database
10488	family	Homeo
10488	medline	18585359
10488	pazar_tf_id	
10488	tax_group	vertebrates
10488	type	universal protein binding microarray (PBM)
10489	class	Helix-Turn-Helix
10489	comment	Data is from Uniprobe database
10489	family	Homeo
10489	medline	18585359
10489	pazar_tf_id	
10489	tax_group	vertebrates
10489	type	universal protein binding microarray (PBM)
10490	class	Helix-Turn-Helix
10490	comment	Data is from Uniprobe database
10490	family	Homeo
10490	medline	18585359
10490	pazar_tf_id	
10490	tax_group	vertebrates
10490	type	universal protein binding microarray (PBM)
10491	class	Helix-Turn-Helix
10491	comment	Data is from Uniprobe database
10491	family	Homeo
10491	medline	18585359
10491	pazar_tf_id	
10491	tax_group	vertebrates
10491	type	universal protein binding microarray (PBM)
10492	class	Helix-Turn-Helix
10492	comment	Data is from Uniprobe database
10492	family	Homeo
10492	medline	18585359
10492	pazar_tf_id	
10492	tax_group	vertebrates
10492	type	universal protein binding microarray (PBM)
10493	class	Helix-Turn-Helix
10493	comment	Data is from Uniprobe database
10493	family	Homeo
10493	medline	18585359
10493	pazar_tf_id	
10493	tax_group	vertebrates
10493	type	universal protein binding microarray (PBM)
10494	class	Helix-Turn-Helix
10494	comment	Data is from Uniprobe database
10494	family	Homeo
10494	medline	18585359
10494	pazar_tf_id	
10494	tax_group	vertebrates
10494	type	universal protein binding microarray (PBM)
10495	class	Helix-Turn-Helix
10495	comment	Data is from Uniprobe database
10495	family	Homeo
10495	medline	18585359
10495	pazar_tf_id	
10495	tax_group	vertebrates
10495	type	universal protein binding microarray (PBM)
10496	class	Helix-Turn-Helix
10496	comment	Data is from Uniprobe database
10496	family	Homeo
10496	medline	18585359
10496	pazar_tf_id	
10496	tax_group	vertebrates
10496	type	universal protein binding microarray (PBM)
10497	class	Helix-Turn-Helix
10497	comment	Data is from Uniprobe database
10497	family	Homeo
10497	medline	18585359
10497	pazar_tf_id	
10497	tax_group	vertebrates
10497	type	universal protein binding microarray (PBM)
10498	class	Helix-Turn-Helix
10498	comment	Data is from Uniprobe database
10498	family	Homeo
10498	medline	18585359
10498	pazar_tf_id	
10498	tax_group	vertebrates
10498	type	universal protein binding microarray (PBM)
10499	class	Helix-Turn-Helix
10499	comment	Data is from Uniprobe database
10499	family	Homeo
10499	medline	18585359
10499	pazar_tf_id	
10499	tax_group	vertebrates
10499	type	universal protein binding microarray (PBM)
10500	class	Helix-Turn-Helix
10500	comment	Data is from Uniprobe database
10500	family	Homeo
10500	medline	18585359
10500	pazar_tf_id	
10500	tax_group	vertebrates
10500	type	universal protein binding microarray (PBM)
10501	class	Helix-Turn-Helix
10501	comment	Data is from Uniprobe database
10501	family	Homeo
10501	medline	18585359
10501	pazar_tf_id	
10501	tax_group	vertebrates
10501	type	universal protein binding microarray (PBM)
10502	class	Helix-Turn-Helix
10502	comment	Data is from Uniprobe database
10502	family	Homeo
10502	medline	18585359
10502	pazar_tf_id	
10502	tax_group	vertebrates
10502	type	universal protein binding microarray (PBM)
10503	class	Helix-Turn-Helix
10503	comment	Data is from Uniprobe database
10503	family	Homeo
10503	medline	18585359
10503	pazar_tf_id	
10503	tax_group	vertebrates
10503	type	universal protein binding microarray (PBM)
10504	class	Helix-Turn-Helix
10504	comment	Data is from Uniprobe database
10504	family	Homeo
10504	medline	18585359
10504	pazar_tf_id	
10504	tax_group	vertebrates
10504	type	universal protein binding microarray (PBM)
10505	class	Helix-Turn-Helix
10505	comment	Data is from Uniprobe database
10505	family	Homeo
10505	medline	18585359
10505	pazar_tf_id	
10505	tax_group	vertebrates
10505	type	universal protein binding microarray (PBM)
10506	class	Helix-Turn-Helix
10506	comment	Data is from Uniprobe database
10506	family	Homeo
10506	medline	18585359
10506	pazar_tf_id	
10506	tax_group	vertebrates
10506	type	universal protein binding microarray (PBM)
10507	class	Zipper-type
10507	comment	homodimer
10507	family	Helix-Loop-Helix
10507	medline	19632181
10507	tax_group	nematodes
10507	type	PBM
10508	class	Zipper-type
10508	comment	heterodimer
10508	family	Helix-Loop-Helix
10508	medline	19632181
10508	tax_group	nematodes
10508	type	PBM
10509	class	Zipper-type
10509	comment	heterodimer
10509	family	Helix-Loop-Helix
10509	medline	19632181
10509	tax_group	nematodes
10509	type	PBM
10510	class	Zipper-type
10510	comment	homodimer
10510	family	Helix-Loop-Helix
10510	medline	19632181
10510	tax_group	nematodes
10510	type	PBM
10511	class	Zipper-type
10511	comment	homodimer
10511	family	Helix-Loop-Helix
10511	medline	19632181
10511	tax_group	nematodes
10511	type	PBM
10512	class	Zipper-type
10512	comment	heterodimer
10512	family	Helix-Loop-Helix
10512	medline	19632181
10512	tax_group	nematodes
10512	type	PBM
10513	class	Zipper-type
10513	comment	homodimer
10513	family	Helix-Loop-Helix
10513	medline	19632181
10513	tax_group	nematodes
10513	type	PBM
10514	class	Zipper-type
10514	comment	homodimer
10514	family	Helix-Loop-Helix
10514	medline	19632181
10514	tax_group	nematodes
10514	type	PBM
10515	class	Zipper-type
10515	comment	homodimer
10515	family	Helix-Loop-Helix
10515	medline	19632181
10515	tax_group	nematodes
10515	type	PBM
10516	class	Zipper-type
10516	comment	heterodimer
10516	family	Helix-Loop-Helix
10516	medline	19632181
10516	tax_group	nematodes
10516	type	PBM
10517	class	Zipper-type
10517	comment	heterodimer
10517	family	Helix-Loop-Helix
10517	medline	19632181
10517	tax_group	nematodes
10517	type	PBM
10518	class	Zipper-type
10518	comment	heterodimer
10518	family	Helix-Loop-Helix
10518	medline	19632181
10518	tax_group	nematodes
10518	type	PBM
10519	class	Zipper-type
10519	comment	heterodimer
10519	family	Helix-Loop-Helix
10519	medline	19632181
10519	tax_group	nematodes
10519	type	PBM
10520	class	Zipper-type
10520	comment	heterodimer
10520	family	Helix-Loop-Helix
10520	medline	19632181
10520	tax_group	nematodes
10520	type	PBM
10521	class	Zipper-type
10521	comment	heterodimer
10521	family	Helix-Loop-Helix
10521	medline	19632181
10521	tax_group	nematodes
10521	type	PBM
10522	class	Zipper-type
10522	comment	homodimer
10522	family	Helix-Loop-Helix
10522	medline	19632181
10522	tax_group	nematodes
10522	type	PBM
10523	class	Zipper-type
10523	comment	heterodimer
10523	family	Helix-Loop-Helix
10523	medline	19632181
10523	tax_group	nematodes
10523	type	PBM
10524	class	Zipper-type
10524	comment	homodimer
10524	family	Helix-Loop-Helix
10524	medline	19632181
10524	tax_group	nematodes
10524	type	PBM
10525	class	Zipper-type
10525	comment	homodimer
10525	family	Helix-Loop-Helix
10525	medline	19632181
10525	tax_group	nematodes
10525	type	PBM
10526	class	Other Alpha-Helix
10526	comment	Annotations from PAZAR SOX10_RAT + SOX10_HUMAN + SOX10_MOUSE (TF0000223, TF0000224, TF0000226) in the pleiades genes project.
10526	family	High Mobility Group box (HMG)
10526	medline	17916232
10526	pazar_tf_id	TF0000224
10526	tax_group	vertebrates
10526	type	COMPILED
10527	class	Zinc-coordinating
10527	comment	-
10527	family	BetaBetaAlpha-zinc finger
10527	medline	18332042
10527	tax_group	insects
10527	type	bacterial 1-hybrid
10528	class	Helix-Turn-Helix
10528	comment	-
10528	family	Homeo
10528	medline	18332042
10528	tax_group	insects
10528	type	bacterial 1-hybrid
10529	class	Other Alpha-Helix
10529	comment	-
10529	family	High Mobility Group box (HMG)
10529	medline	18332042
10529	tax_group	insects
10529	type	bacterial 1-hybrid
10530	class	Winged Helix-Turn-Helix
10530	comment	-
10530	family	Forkhead
10530	medline	18332042
10530	tax_group	insects
10530	type	bacterial 1-hybrid
10531	class	Zipper-type
10531	comment	-
10531	family	Leucine Zipper
10531	medline	18332042
10531	tax_group	insects
10531	type	bacterial 1-hybrid
10532	class	Helix-Turn-Helix
10532	comment	-
10532	family	Homeo
10532	medline	18332042
10532	tax_group	insects
10532	type	bacterial 1-hybrid
10533	class	Zipper-type
10533	comment	-
10533	family	Helix-Loop-Helix
10533	medline	18332042
10533	tax_group	insects
10533	type	bacterial 1-hybrid
10534	class	Zinc-coordinating
10534	comment	-
10534	family	BetaBetaAlpha-zinc finger
10534	medline	18332042
10534	tax_group	insects
10534	type	bacterial 1-hybrid
10535	class	Zinc-coordinating
10535	comment	-
10535	family	Hormone-nuclear Receptor
10535	medline	18332042
10535	tax_group	insects
10535	type	bacterial 1-hybrid
10536	class	Zinc-coordinating
10536	comment	-
10536	family	BetaBetaAlpha-zinc finger
10536	medline	18332042
10536	tax_group	insects
10536	type	bacterial 1-hybrid
10537	class	Zinc-coordinating
10537	comment	-
10537	family	BetaBetaAlpha-zinc finger
10537	medline	18332042
10537	tax_group	insects
10537	type	bacterial 1-hybrid
10538	class	Zinc-coordinating
10538	comment	-
10538	family	BetaBetaAlpha-zinc finger
10538	medline	18332042
10538	tax_group	insects
10538	type	bacterial 1-hybrid
10755	tfbs_shape_id	367
10754	tfbs_shape_id	366
10753	tfbs_shape_id	365
10540	class	Zinc-coordinating
10540	comment	-
10540	family	BetaBetaAlpha-zinc finger
10540	medline	18332042
10540	tax_group	insects
10540	type	bacterial 1-hybrid
10541	class	Helix-Turn-Helix
10541	comment	-
10541	family	Homeo
10541	medline	18332042
10541	tax_group	insects
10541	type	bacterial 1-hybrid
10542	class	Winged Helix-Turn-Helix
10542	comment	-
10542	family	Forkhead
10542	medline	18332042
10542	tax_group	insects
10542	type	bacterial 1-hybrid
10543	class	Zinc-coordinating
10543	comment	-
10543	family	Hormone-nuclear Receptor
10543	medline	18332042
10543	tax_group	insects
10543	type	bacterial 1-hybrid
10544	class	Other
10544	comment	-
10544	family	AT-hook
10544	medline	18332042
10544	tax_group	insects
10544	type	bacterial 1-hybrid
10579	family	BetaBetaAlpha-zinc finger
10580	tax_group	vertebrates
10580	medline	18798982
10580	pazar_tf_id	TF0000263
10580	comment	-
10580	class	Winged Helix-Turn-Helix
10579	comment	zinc finger protein,X-linked
10578	type	ChiP-seq
10578	family	CP2
10579	tax_group	vertebrates
10579	medline	18555785
10579	pazar_tf_id	-\	
10578	comment	transcription factor CP2-like 1
10578	class	Other
10577	family	High Mobility Group box (HMG-box)
10578	tax_group	vertebrates
10578	medline	18555785
10578	pazar_tf_id	-\	
10576	tax_group	vertebrates
10576	medline	18555785
10576	comment	estrogen-related receptor beta
10576	pazar_tf_id	-\	
10576	class	Zinc-coordinating
10576	type	ChiP-seq
10576	family	Hormone-nuclear Receptor
10577	tax_group	vertebrates
10577	medline	18555785
10577	pazar_tf_id	TF0000779
10577	comment	-
10577	class	Other Alpha-Helix
10577	type	ChiP-seq
10580	type	ChiP-Seq
10580	family	Forkhead
10648	type	ChIP-seq
10648	source	ENCODE
10648	centrality_logp	-1370
10648	family	BetaBetaAlpha-zinc Finger
10647	source	ENCODE
10648	medline	19887448
10648	tax_group	vertebrates
10648	class	Zinc-coordinating
10647	centrality_logp	-542
10647	type	ChIP-seq
10647	pazar_tf_id	TF0000910
10647	tax_group	vertebrates
10647	class	Zinc-coordinating
10647	family	BetaBetaAlpha-zinc Finger
10646	source	ENCODE
10647	medline	23693142
10646	type	ChIP-seq
10646	class	Zipper-Type
10646	family	Helix-Loop-Helix
10646	centrality_logp	-12079
10646	medline	8943301
10646	tax_group	vertebrates
10645	source	PAZAR
10645	family	Loop-Sheet-Helix
10645	centrality_logp	-8021
10645	type	ChIP-seq
10645	tax_group	vertebrates
10645	class	Zinc-coordinating
10645	medline	17188034
10644	class	Zipper-Type
10644	family	Helix-Loop-Helix
10644	centrality_logp	-13700
10644	type	ChIP-seq
10644	source	PAZAR
10644	medline	20629094
10644	tax_group	vertebrates
10643	source	ENCODE
10643	class	Other Alpha-Helix
10643	family	High Mobility Group (Box)
10643	centrality_logp	-3103
10643	type	ChIP-seq
10643	medline	18268006
10643	tax_group	vertebrates
10642	source	PAZAR
10642	family	High Mobility Group (Box)
10642	pazar_tf_id	TF0000397
10642	centrality_logp	-11425
10642	type	ChIP-seq
10642	class	Other Alpha-Helix
10642	tax_group	vertebrates
10641	centrality_logp	-9716
10641	type	ChIP-seq
10641	source	ENCODE
10642	medline	10594029
10641	family	Helix-Loop-Helix
10641	class	Zipper-Type
10640	type	ChIP-seq
10640	source	PAZAR
10641	medline	1501295
10641	tax_group	vertebrates
10640	family	STAT
10640	centrality_logp	-1349
10640	class	Other
10639	centrality_logp	-8775
10639	type	ChIP-seq
10639	source	PAZAR
10640	medline	21828071
10640	tax_group	vertebrates
10639	class	Other
10639	family	STAT
10639	tax_group	vertebrates
10638	family	STAT
10638	centrality_logp	-2208
10638	type	ChIP-seq
10638	source	PAZAR
10639	medline	22158971
10581	medline	21795538
10581	tax_group	vertebrates
10581	class	Zipper-Type
10581	family	Helix-Loop-Helix
10581	pazar_tf_id	TF0001119
10581	centrality_logp	-6329
10581	type	ChIP-seq
10581	source	PAZAR
10582	medline	8570175, 10777209, 22992523
10582	tax_group	vertebrates
10582	class	Zipper-Type
10582	family	Leucine-Zipper
10582	centrality_logp	-7616
10582	type	ChIP-seq
10582	source	ENCODE
10583	medline	7945383, 8692924
10583	tax_group	vertebrates
10583	class	Zinc-coordinating
10583	family	BetaBetaAlpha-zinc Finger
10583	centrality_logp	-488
10583	type	ChIP-seq
10583	source	PAZAR
10584	medline	11880636
10584	tax_group	vertebrates
10584	class	Zipper-Type
10584	family	Helix-Loop-Helix
10584	centrality_logp	-14754
10584	type	ChIP-seq
10584	source	ENCODE
10585	medline	20696899
10585	tax_group	vertebrates
10585	class	Helix-Turn-Helix
10585	family	Homeodomain
10585	pazar_tf_id	TF0000770
10585	centrality_logp	-598
10585	type	ChIP-seq
10585	source	PAZAR
10586	medline	8380454
10586	tax_group	vertebrates
10586	class	Zipper-Type
10586	family	Leucine-Zipper
10586	centrality_logp	-188131
10586	type	ChIP-seq
10586	source	ENCODE
10587	medline	20463752
10587	tax_group	vertebrates
10587	class	Helix-Turn-Helix
10587	family	Homeodomain
10587	centrality_logp	-2852
10587	type	ChIP-seq
10587	source	PAZAR
10588	medline	22209328
10588	tax_group	vertebrates
10588	class	Helix-Turn-Helix
10588	family	Homeodomain
10588	centrality_logp	-21394
10588	type	ChIP-seq
10588	source	PAZAR
10589	medline	1411535
10589	tax_group	vertebrates
10589	class	Winged Helix-Turn-Helix
10589	family	E2F
10589	centrality_logp	-809
10589	type	ChIP-seq
10589	source	PAZAR
10590	medline	17908821
10590	tax_group	vertebrates
10590	class	Winged Helix-Turn-Helix
10590	family	E2F
10590	centrality_logp	-518
10590	type	ChIP-seq
10590	source	ENCODE
10591	medline	17908821
10591	tax_group	vertebrates
10591	class	Winged Helix-Turn-Helix
10591	family	E2F
10591	centrality_logp	-552
10591	type	ChIP-seq
10591	source	ENCODE
10592	medline	7891721
10592	tax_group	vertebrates
10592	class	Zinc-coordinating
10592	family	BetaBetaAlpha-zinc Finger
10592	pazar_tf_id	TF0000229
10592	centrality_logp	-438
10592	type	ChIP-seq
10592	source	PAZAR
10593	medline	20517297
10593	tax_group	vertebrates
10593	class	Winged Helix-Turn-Helix
10593	family	ETS
10593	centrality_logp	-10512
10593	type	ChIP-seq
10593	source	ENCODE
10594	medline	23093599
10594	tax_group	vertebrates
10594	class	Winged Helix-Turn-Helix
10594	family	ETS
10594	centrality_logp	-8417
10594	type	ChIP-seq
10594	source	PAZAR
10595	medline	7517940
10595	tax_group	vertebrates
10595	class	Winged Helix-Turn-Helix
10595	family	ETS
10595	centrality_logp	-2277
10595	type	ChIP-seq
10595	source	PAZAR
10596	medline	17916232
10596	tax_group	vertebrates
10596	class	Zipper-Type
10596	family	Leucine-Zipper
10596	centrality_logp	-33384
10596	type	ChIP-seq
10596	source	ENCODE
10597	medline	17916232
10597	tax_group	vertebrates
10597	class	Zipper-Type
10597	family	Leucine-Zipper
10597	pazar_tf_id	TF0000673
10597	centrality_logp	-5402
10597	type	ChIP-seq
10597	source	ENCODE
10598	medline	17916232
10598	tax_group	vertebrates
10598	class	Zipper-Type
10598	family	Leucine-Zipper
10598	centrality_logp	-3176
10598	type	ChIP-seq
10598	source	ENCODE
10599	medline	9702198
10599	tax_group	vertebrates
10599	class	Winged Helix-Turn-Helix
10599	family	Forkhead
10599	pazar_tf_id	TF0000679
10599	centrality_logp	-6184
10599	type	ChIP-seq
10599	source	PAZAR
10600	medline	10880363
10600	tax_group	vertebrates
10600	class	Winged Helix-Turn-Helix
10600	family	Forkhead
10600	pazar_tf_id	TF0000809
10600	centrality_logp	-1578
10600	type	ChIP-seq
10600	source	PAZAR
10601	medline	21924763
10601	tax_group	vertebrates
10601	class	Winged Helix-Turn-Helix
10601	family	Forkhead
10601	pazar_tf_id	TF0000805
10601	centrality_logp	-48
10601	type	ChIP-seq
10601	source	PAZAR
10602	medline	7791790
10602	tax_group	vertebrates
10602	class	Zinc-coordinating
10602	family	GATA
10602	pazar_tf_id	TF0000276
10602	centrality_logp	-1496
10602	type	ChIP-seq
10602	source	PAZAR
10603	medline	19773260
10603	tax_group	vertebrates
10603	class	Zinc-coordinating
10603	family	BetaBetaAlpha-zinc Finger
10603	centrality_logp	-1297
10603	type	ChIP-seq
10603	source	PAZAR
10604	medline	22383578
10604	tax_group	vertebrates
10604	class	Zinc-coordinating
10604	family	Hormone-nuclear Receptor
10604	pazar_tf_id	TF0000903
10604	centrality_logp	-6579
10604	type	ChIP-seq
10604	source	ENCODE
10605	medline	9079637
10605	tax_group	vertebrates
10605	class	Helix-Turn-Helix
10605	family	Homeodomain
10605	centrality_logp	-685
10605	type	ChIP-seq
10605	source	PAZAR
10606	medline	17500587
10606	tax_group	vertebrates
10606	class	Winged Helix-Turn-Helix
10606	family	HSF
10606	pazar_tf_id	TF0000427
10606	centrality_logp	-226
10606	type	ChIP-seq
10606	source	ENCODE
10608	medline	21703547
10608	tax_group	vertebrates
10608	class	Zipper-Type
10608	family	Leucine-Zipper
10608	pazar_tf_id	TF0000931
10608	centrality_logp	-21834
10608	type	ChIP-seq
10608	source	ENCODE
10609	medline	21703547
10609	tax_group	vertebrates
10609	class	Zipper-Type
10609	family	Leucine-Zipper
10609	pazar_tf_id	TF0000932
10609	centrality_logp	-12463
10609	type	ChIP-seq
10609	source	ENCODE
10610	medline	21526160
10610	tax_group	vertebrates
10610	class	Zipper-Type
10610	family	Leucine-Zipper
10610	centrality_logp	-13107
10610	type	ChIP-seq
10610	source	ENCODE
10611	medline	21526160
10611	tax_group	vertebrates
10611	class	Zipper-Type
10611	family	Leucine-Zipper
10611	centrality_logp	-40021
10611	type	ChIP-seq
10611	source	ENCODE
10612	medline	21526160
10612	tax_group	vertebrates
10612	class	Zipper-Type
10612	family	Leucine-Zipper
10612	centrality_logp	-39773
10612	type	ChIP-seq
10612	source	ENCODE
10613	medline	7682653
10613	tax_group	vertebrates
10613	class	Zinc-coordinating
10613	family	BetaBetaAlpha-zinc Finger
10613	centrality_logp	-232
10613	type	ChIP-seq
10613	source	PAZAR
10614	medline	21349840
10614	tax_group	vertebrates
10614	class	Zinc-coordinating
10614	family	Hormone-nuclear Receptor
10614	centrality_logp	-444
10614	type	ChIP-seq
10614	source	PAZAR
10615	medline	8264639
10615	tax_group	vertebrates
10615	class	Zipper-Type
10615	family	Leucine-Zipper
10615	centrality_logp	-71624
10615	type	ChIP-seq
10615	source	ENCODE
10616	medline	8264639
10616	tax_group	vertebrates
10616	class	Zipper-Type
10616	family	Leucine-Zipper
10616	centrality_logp	-90354
10616	type	ChIP-seq
10616	source	ENCODE
10617	medline	7559475
10617	tax_group	vertebrates
10617	class	Other Alpha-Helix
10617	family	MADS
10617	centrality_logp	-939
10617	type	ChIP-seq
10617	source	ENCODE
10618	medline	9315626
10618	tax_group	vertebrates
10618	class	Helix-Turn-Helix
10618	family	Homeodomain
10618	centrality_logp	-2086
10618	type	ChIP-seq
10618	source	PAZAR
10619	medline	20412780
10619	tax_group	vertebrates
10619	class	Zipper-Type
10619	family	Helix-Loop-Helix
10619	pazar_tf_id	TF0000591
10619	centrality_logp	-24098
10619	type	ChIP-seq
10619	source	ENCODE
10620	medline	16437161
10620	tax_group	vertebrates
10620	class	Zipper-Type
10620	family	Helix-Loop-Helix
10620	pazar_tf_id	TF0000590
10620	centrality_logp	-12187
10620	type	ChIP-seq
10620	source	ENCODE
10621	medline	9166829
10621	tax_group	vertebrates
10621	class	Zipper-Type
10621	family	Leucine-Zipper
10621	centrality_logp	-2061
10621	type	ChIP-seq
10621	source	ENCODE
10622	medline	9334236
10622	tax_group	vertebrates
10622	class	Other Alpha-Helix
10622	family	NF-Y CCAAT-Binding
10622	centrality_logp	-4266
10622	type	ChIP-seq
10622	source	ENCODE
10623	medline	7797561
10623	tax_group	vertebrates
10623	class	Helix-Turn-Helix
10623	family	Homeodomain
10623	pazar_tf_id	TF0000040
10623	centrality_logp	-1814
10623	type	ChIP-seq
10623	source	PAZAR
10624	medline	11478808
10624	tax_group	vertebrates
10624	class	Zinc-coordinating
10624	family	Hormone-nuclear Receptor
10624	centrality_logp	-306
10624	type	ChIP-seq
10624	source	ENCODE
10625	medline	12853459
10625	tax_group	vertebrates
10625	class	Zinc-coordinating
10625	family	Hormone-nuclear Receptor
10625	centrality_logp	-791
10625	type	ChIP-seq
10625	source	PAZAR
10626	medline	12533512
10626	tax_group	vertebrates
10626	class	Other
10626	family	NRF
10626	centrality_logp	-3573
10626	type	ChIP-seq
10626	source	ENCODE
10627	medline	11937630
10627	tax_group	vertebrates
10627	class	Helix-Turn-Helix
10627	family	Homeodomain
10627	centrality_logp	-948
10627	type	ChIP-seq
10627	source	ENCODE
10628	medline	20421211
10628	tax_group	vertebrates
10628	class	Zinc-coordinating
10628	family	BetaBetaAlpha-zinc Finger
10628	pazar_tf_id	TF0001103
10628	centrality_logp	-3370
10628	type	ChIP-seq
10628	source	ENCODE
10629	medline	20189986
10629	tax_group	vertebrates
10629	class	Winged Helix-Turn-Helix
10629	family	RFX
10629	centrality_logp	-1359
10629	type	ChIP-seq
10629	source	PAZAR
10630	medline	8754849
10630	tax_group	vertebrates
10630	class	Winged Helix-Turn-Helix
10630	family	RFX
10630	centrality_logp	-1029
10630	type	ChIP-seq
10630	source	ENCODE
10631	medline	22158627
10631	tax_group	vertebrates
10631	class	Other
10631	family	Runt
10631	centrality_logp	-383
10631	type	ChIP-seq
10631	source	PAZAR
10632	medline	10669605
10632	tax_group	vertebrates
10632	class	Zinc-coordinating
10632	family	Hormone-nuclear Receptor
10632	pazar_tf_id	TF0000487
10632	centrality_logp	-2615
10632	type	ChIP-seq
10632	source	PAZAR
10633	medline	9741623
10633	tax_group	vertebrates
10633	class	Zinc-coordinating
10633	family	MH1
10633	centrality_logp	-460
10633	type	ChIP-seq
10633	source	PAZAR
10634	medline	8625802
10634	tax_group	vertebrates
10634	class	Other Alpha-Helix
10634	family	High Mobility Group (Box)
10634	centrality_logp	-467
10634	type	ChIP-seq
10634	source	PAZAR
10635	medline	21985497
10635	tax_group	vertebrates
10635	class	Other Alpha-Helix
10635	family	High Mobility Group (Box)
10635	centrality_logp	-110
10635	type	ChIP-seq
10635	source	PAZAR
10636	medline	22684502
10636	tax_group	vertebrates
10636	class	Zinc-coordinating
10636	family	BetaBetaAlpha-zinc Finger
10636	centrality_logp	-144
10636	type	ChIP-seq
10636	source	ENCODE
10637	medline	16319195
10637	tax_group	vertebrates
10637	class	Other
10637	family	STAT
10637	centrality_logp	-665
10637	type	ChIP-seq
10637	source	ENCODE
10638	medline	19710469
10638	tax_group	vertebrates
10638	class	Other
10665	tfbs_shape_id	261
10664	tfbs_shape_id	54
10663	tfbs_shape_id	59
10662	tfbs_shape_id	260
10661	tfbs_shape_id	259
10660	tfbs_shape_id	41
10659	tfbs_shape_id	40
10658	tfbs_shape_id	258
10656	tfbs_shape_id	97
10655	tfbs_shape_id	237
10654	tfbs_shape_id	76
10653	tfbs_shape_id	150
10652	tfbs_shape_id	6
10651	tfbs_shape_id	31
10650	tfbs_shape_id	257
10649	tfbs_shape_id	14
10648	tfbs_shape_id	328
10647	tfbs_shape_id	327
10646	tfbs_shape_id	326
10645	tfbs_shape_id	325
10644	tfbs_shape_id	324
10643	tfbs_shape_id	323
10642	tfbs_shape_id	322
10641	tfbs_shape_id	321
10640	tfbs_shape_id	320
10581	tfbs_shape_id	265
10582	tfbs_shape_id	266
10583	tfbs_shape_id	267
10584	tfbs_shape_id	268
10585	tfbs_shape_id	269
10586	tfbs_shape_id	270
10587	tfbs_shape_id	271
10588	tfbs_shape_id	272
10589	tfbs_shape_id	273
10590	tfbs_shape_id	274
10591	tfbs_shape_id	275
10592	tfbs_shape_id	276
10593	tfbs_shape_id	277
10594	tfbs_shape_id	278
10595	tfbs_shape_id	279
10596	tfbs_shape_id	280
10597	tfbs_shape_id	281
10598	tfbs_shape_id	282
10599	tfbs_shape_id	283
10600	tfbs_shape_id	284
10601	tfbs_shape_id	285
10602	tfbs_shape_id	286
10603	tfbs_shape_id	287
10604	tfbs_shape_id	288
10605	tfbs_shape_id	289
10606	tfbs_shape_id	290
10608	tfbs_shape_id	291
10610	tfbs_shape_id	292
10611	tfbs_shape_id	293
10613	tfbs_shape_id	294
10614	tfbs_shape_id	295
10615	tfbs_shape_id	296
10616	tfbs_shape_id	297
10617	tfbs_shape_id	298
10618	tfbs_shape_id	299
10619	tfbs_shape_id	300
10620	tfbs_shape_id	301
10621	tfbs_shape_id	302
10622	tfbs_shape_id	303
10624	tfbs_shape_id	304
10625	tfbs_shape_id	305
10626	tfbs_shape_id	306
10627	tfbs_shape_id	307
10628	tfbs_shape_id	308
10629	tfbs_shape_id	309
10630	tfbs_shape_id	310
10631	tfbs_shape_id	311
10632	tfbs_shape_id	312
10633	tfbs_shape_id	313
10634	tfbs_shape_id	314
10635	tfbs_shape_id	315
10636	tfbs_shape_id	316
10637	tfbs_shape_id	317
10638	tfbs_shape_id	318
10639	tfbs_shape_id	319
10577	tfbs_shape_id	136
10580	tfbs_shape_id	141
10544	tfbs_shape_id	256
10543	tfbs_shape_id	255
10542	tfbs_shape_id	254
10541	tfbs_shape_id	253
10540	tfbs_shape_id	252
10538	tfbs_shape_id	251
10537	tfbs_shape_id	250
10535	tfbs_shape_id	248
10534	tfbs_shape_id	247
10533	tfbs_shape_id	246
10531	tfbs_shape_id	244
10530	tfbs_shape_id	243
10528	tfbs_shape_id	242
10527	tfbs_shape_id	241
9505	tfbs_shape_id	240
9504	tfbs_shape_id	239
9503	tfbs_shape_id	238
9501	tfbs_shape_id	93
9500	tfbs_shape_id	236
9499	tfbs_shape_id	235
9498	tfbs_shape_id	234
9497	tfbs_shape_id	233
9496	tfbs_shape_id	232
9495	tfbs_shape_id	231
9494	tfbs_shape_id	230
9493	tfbs_shape_id	229
9492	tfbs_shape_id	228
9491	tfbs_shape_id	227
9489	tfbs_shape_id	225
9488	tfbs_shape_id	224
9487	tfbs_shape_id	223
9486	tfbs_shape_id	222
9485	tfbs_shape_id	221
9484	tfbs_shape_id	220
9483	tfbs_shape_id	219
9482	tfbs_shape_id	218
9481	tfbs_shape_id	217
9479	tfbs_shape_id	215
9478	tfbs_shape_id	214
9477	tfbs_shape_id	213
9476	tfbs_shape_id	212
9475	tfbs_shape_id	211
9474	tfbs_shape_id	210
9473	tfbs_shape_id	99
9472	tfbs_shape_id	209
9471	tfbs_shape_id	208
9470	tfbs_shape_id	207
9469	tfbs_shape_id	206
9468	tfbs_shape_id	205
9467	tfbs_shape_id	204
9465	tfbs_shape_id	4
9464	tfbs_shape_id	203
9463	tfbs_shape_id	202
9462	tfbs_shape_id	201
9461	tfbs_shape_id	200
9460	tfbs_shape_id	199
9458	tfbs_shape_id	197
9457	tfbs_shape_id	196
9456	tfbs_shape_id	195
9455	tfbs_shape_id	194
9454	tfbs_shape_id	193
9453	tfbs_shape_id	192
9452	tfbs_shape_id	191
9451	tfbs_shape_id	190
9450	tfbs_shape_id	189
9449	tfbs_shape_id	188
9448	tfbs_shape_id	187
9447	tfbs_shape_id	186
9446	tfbs_shape_id	185
9445	tfbs_shape_id	184
9444	tfbs_shape_id	183
9443	tfbs_shape_id	182
9442	tfbs_shape_id	181
9440	tfbs_shape_id	180
9438	tfbs_shape_id	178
9437	tfbs_shape_id	177
9436	tfbs_shape_id	176
9435	tfbs_shape_id	175
9434	tfbs_shape_id	174
9433	tfbs_shape_id	173
9432	tfbs_shape_id	172
9431	tfbs_shape_id	171
9430	tfbs_shape_id	170
9429	tfbs_shape_id	169
9428	tfbs_shape_id	168
9427	tfbs_shape_id	167
9426	tfbs_shape_id	166
9425	tfbs_shape_id	165
9424	tfbs_shape_id	164
9423	tfbs_shape_id	163
9422	tfbs_shape_id	162
9421	tfbs_shape_id	161
9420	tfbs_shape_id	160
9419	tfbs_shape_id	159
9418	tfbs_shape_id	158
9417	tfbs_shape_id	9
9416	tfbs_shape_id	157
9415	tfbs_shape_id	156
9414	tfbs_shape_id	155
9413	tfbs_shape_id	154
9412	tfbs_shape_id	153
9411	tfbs_shape_id	152
9410	tfbs_shape_id	8
9409	tfbs_shape_id	151
9408	tfbs_shape_id	3
9405	tfbs_shape_id	98
9404	tfbs_shape_id	25
9398	tfbs_shape_id	149
9397	tfbs_shape_id	148
9396	tfbs_shape_id	147
9395	tfbs_shape_id	146
9394	tfbs_shape_id	145
9393	tfbs_shape_id	7
9391	tfbs_shape_id	2
9390	tfbs_shape_id	1
9389	tfbs_shape_id	144
9387	tfbs_shape_id	66
9386	tfbs_shape_id	108
9385	tfbs_shape_id	50
9383	tfbs_shape_id	131
9381	tfbs_shape_id	132
9380	tfbs_shape_id	43
9378	tfbs_shape_id	63
9377	tfbs_shape_id	142
9374	tfbs_shape_id	139
9373	tfbs_shape_id	138
9370	tfbs_shape_id	135
9369	tfbs_shape_id	134
9367	tfbs_shape_id	133
9364	tfbs_shape_id	130
9363	tfbs_shape_id	129
9362	tfbs_shape_id	128
9361	tfbs_shape_id	127
9360	tfbs_shape_id	126
9359	tfbs_shape_id	125
9358	tfbs_shape_id	124
9357	tfbs_shape_id	123
9356	tfbs_shape_id	122
9355	tfbs_shape_id	121
9354	tfbs_shape_id	120
9353	tfbs_shape_id	119
9352	tfbs_shape_id	118
9351	tfbs_shape_id	117
9350	tfbs_shape_id	116
9349	tfbs_shape_id	115
9348	tfbs_shape_id	114
9347	tfbs_shape_id	113
9346	tfbs_shape_id	112
9345	tfbs_shape_id	111
9344	tfbs_shape_id	110
9342	tfbs_shape_id	109
9340	tfbs_shape_id	107
9339	tfbs_shape_id	106
9335	tfbs_shape_id	105
9329	tfbs_shape_id	100
9325	tfbs_shape_id	96
9324	tfbs_shape_id	95
9320	tfbs_shape_id	91
9319	tfbs_shape_id	90
9317	tfbs_shape_id	89
9316	tfbs_shape_id	88
9315	tfbs_shape_id	87
9314	tfbs_shape_id	86
9313	tfbs_shape_id	85
9312	tfbs_shape_id	84
9310	tfbs_shape_id	82
9309	tfbs_shape_id	81
9306	tfbs_shape_id	78
9305	tfbs_shape_id	77
9303	tfbs_shape_id	75
9302	tfbs_shape_id	74
9301	tfbs_shape_id	73
9300	tfbs_shape_id	72
9299	tfbs_shape_id	71
9298	tfbs_shape_id	70
9297	tfbs_shape_id	69
9295	tfbs_shape_id	68
9294	tfbs_shape_id	67
9292	tfbs_shape_id	65
9291	tfbs_shape_id	64
9289	tfbs_shape_id	62
9287	tfbs_shape_id	60
9285	tfbs_shape_id	58
9284	tfbs_shape_id	57
9281	tfbs_shape_id	55
9279	tfbs_shape_id	53
10649	medline	20943813
10649	tax_group	vertebrates
10649	class	Zinc-coordinating
10649	family	Hormone-nuclear Receptor
10649	pazar_tf_id	TF0000005
10649	centrality_logp	-6295
10649	type	ChIP-seq
10649	source	PAZAR
10650	medline	1672737
10650	tax_group	vertebrates
10650	class	Zipper-Type
10650	family	Leucine Zipper
10650	pazar_tf_id	-
10650	centrality_logp	-20537
10650	type	ChIP-seq
10650	source	PAZAR
10651	medline	17908821
10651	tax_group	vertebrates
10651	class	Winged Helix-Turn-Helix
10651	family	E2F
10651	pazar_tf_id	TF0000014
10651	centrality_logp	-264
10651	type	ChIP-seq
10651	source	ENCODE
10652	medline	17916232
10652	tax_group	vertebrates
10652	class	Zipper-Type
10652	family	Helix-Loop-Helix
10652	pazar_tf_id	TF0000762
10652	centrality_logp	-20994
10652	type	ChIP-seq
10652	source	ENCODE
10653	medline	16041365
10653	tax_group	vertebrates
10653	class	Zinc-coordinating
10653	family	BetaBetaAlpha-zinc finger
10653	pazar_tf_id	TF0000345
10653	centrality_logp	-3993
10653	type	ChIP-seq
10653	source	ENCODE
10654	medline	8524663
10654	tax_group	vertebrates
10654	class	Winged Helix-Turn-Helix
10654	family	Ets
10654	pazar_tf_id	TF0000052
10654	centrality_logp	-1975
10654	type	ChIP-seq
10654	source	ENCODE
10655	medline	18272478
10655	tax_group	vertebrates
10655	class	Zinc-coordinating
10655	family	Hormone-nuclear Receptor
10655	pazar_tf_id	-
10655	centrality_logp	-7941
10655	type	ChIP-seq
10655	source	PAZAR
10656	medline	1542566
10656	tax_group	vertebrates
10656	class	Winged Helix-Turn-Helix
10656	family	Ets
10656	pazar_tf_id	TF0000070
10656	centrality_logp	-1228
10656	type	ChIP-seq
10656	source	PAZAR
10657	medline	18798982
10657	tax_group	vertebrates
10657	class	Winged Helix-Turn-Helix
10657	family	Forkhead
10657	pazar_tf_id	TF0000263
10657	centrality_logp	-21202
10657	type	ChIP-seq
10657	source	PAZAR
10658	medline	1638017
10658	tax_group	vertebrates
10658	class	Zinc-coordinating
10658	family	GATA
10658	pazar_tf_id	TF0000022
10658	centrality_logp	-25619
10658	type	ChIP-seq
10658	source	ENCODE
10659	medline	8321207
10659	tax_group	vertebrates
10659	class	Zinc-coordinating
10659	family	GATA
10659	pazar_tf_id	TF0000023
10659	centrality_logp	-3777
10659	type	ChIP-seq
10659	source	ENCODE
10660	medline	8321207
10660	tax_group	vertebrates
10660	class	Zinc-coordinating
10660	family	GATA
10660	pazar_tf_id	TF0000024
10660	centrality_logp	-2293
10660	type	ChIP-seq
10660	source	PAZAR
10661	medline	12385991
10661	tax_group	vertebrates
10661	class	Zinc-coordinating
10661	family	Hormone-nuclear Receptor
10661	pazar_tf_id	-
10661	centrality_logp	-15721
10661	type	ChIP-seq
10661	source	PAZAR
10662	medline	21803131
10662	tax_group	vertebrates
10662	class	Winged Helix-Turn-Helix
10662	family	IRF
10662	pazar_tf_id	TF0000918
10662	centrality_logp	-1137
10662	type	ChIP-seq
10662	source	ENCODE
10663	medline	8265351
10663	tax_group	vertebrates
10663	class	Zipper-Type
10663	family	Helix-Loop-Helix
10663	pazar_tf_id	TF0000037
10663	centrality_logp	-28242
10663	type	ChIP-seq
10663	source	ENCODE
10664	medline	1748287
10664	tax_group	vertebrates
10664	class	Other Alpha-Helix
10664	family	MADS
10664	pazar_tf_id	TF0000034
10664	centrality_logp	-1223
10664	type	ChIP-seq
10664	source	ENCODE
10665	medline	8467793
10665	tax_group	vertebrates
10665	class	Helix-Turn-Helix
10665	family	Myb
10665	pazar_tf_id	TF0000072
10665	centrality_logp	-581
10665	type	ChIP-seq
10665	source	ENCODE
10666	medline	18555785
10666	tax_group	vertebrates
10666	class	Zipper-Type
10666	family	Helix-Loop-Helix
10666	pazar_tf_id	TF0000420
10666	centrality_logp	-3777
10666	type	ChIP-seq
10666	source	ENCODE
10667	medline	18555785
10667	tax_group	vertebrates
10667	class	Zipper-Type
10667	family	Helix-Loop-Helix
10667	pazar_tf_id	TF0000075
10667	centrality_logp	-1142
10667	type	ChIP-seq
10667	source	PAZAR
10668	medline	17916232
10668	tax_group	vertebrates
10668	class	Zipper-Type
10668	family	Leucine Zipper
10668	pazar_tf_id	TF0000699
10668	centrality_logp	-624
10668	type	ChIP-seq
10668	source	PAZAR
10669	medline	1406630
10669	tax_group	vertebrates
10669	class	Ig-fold
10669	family	Rel
10669	pazar_tf_id	TF0000076
10669	centrality_logp	-4738
10669	type	ChIP-seq
10669	source	PAZAR
10670	medline	9469818
10670	tax_group	vertebrates
10670	class	Other Alpha-Helix
10670	family	NFY CCAAT-binding
10670	pazar_tf_id	-
10670	centrality_logp	-3434
10670	type	ChIP-seq
10670	source	PAZAR
10671	medline	8406007
10671	tax_group	vertebrates
10671	class	Helix-Turn-Helix
10671	family	Homeo
10671	pazar_tf_id	TF0000011
10671	centrality_logp	-576
10671	type	ChIP-seq
10671	source	ENCODE
10672	medline	17916232
10672	tax_group	vertebrates
10672	class	Winged Helix-Turn-Helix
10672	family	Ets
10672	pazar_tf_id	TF0000056
10672	centrality_logp	-71772
10672	type	ChIP-seq
10672	source	PAZAR
10673	medline	15863505
10673	tax_group	vertebrates
10673	class	Other Alpha-Helix
10673	family	High Mobility Group box (HMG)
10673	pazar_tf_id	TF0000779
10673	centrality_logp	-971
10673	type	ChIP-seq
10673	source	PAZAR
10674	medline	17916232
10674	tax_group	vertebrates
10674	class	Zinc-coordinating
10674	family	BetaBetaAlpha-zinc finger
10674	pazar_tf_id	TF0000055
10674	centrality_logp	-568
10674	type	ChIP-seq
10674	source	ENCODE
10675	medline	2243767
10675	tax_group	vertebrates
10675	class	Other Alpha-Helix
10675	family	MADS
10675	pazar_tf_id	TF0000058
10675	centrality_logp	-2549
10675	type	ChIP-seq
10675	source	ENCODE
10676	medline	17558387
10676	tax_group	vertebrates
10676	class	Ig-fold
10676	family	Stat
10676	pazar_tf_id	TF0000829
10676	centrality_logp	-2937
10676	type	ChIP-seq
10676	source	ENCODE
10677	medline	18555785
10677	tax_group	vertebrates
10677	class	Ig-fold
10677	family	Stat
10677	pazar_tf_id	TF0000492
10677	centrality_logp	-8059
10677	type	ChIP-seq
10677	source	ENCODE
10678	medline	20566737
10678	tax_group	vertebrates
10678	class	Zipper-Type
10678	family	Helix-Loop-Helix
10678	pazar_tf_id	TF0000022
10678	centrality_logp	-3596
10678	type	ChIP-seq
10678	source	ENCODE
10679	medline	10497269
10679	tax_group	vertebrates
10679	class	Zipper-Type
10679	family	Helix-Loop-Helix
10679	pazar_tf_id	TF0000002
10679	centrality_logp	-4343
10679	type	ChIP-seq
10679	source	ENCODE
10680	medline	1588974
10680	tax_group	vertebrates
10680	class	Zinc-coordinating
10680	family	Loop-Sheet-Helix
10680	pazar_tf_id	TF0000077
10680	centrality_logp	-1652
10680	type	ChIP-seq
10680	source	PAZAR
10681	medline	8052536
10681	tax_group	vertebrates
10681	class	Zipper-Type
10681	family	Helix-Loop-Helix
10681	pazar_tf_id	TF0000067
10681	centrality_logp	-17373
10681	type	ChIP-seq
10681	source	ENCODE
10682	medline	18950698
10682	tax_group	vertebrates
10682	class	Zinc-coordinating
10682	family	BetaBetaAlpha-zinc finger
10682	pazar_tf_id	TF0000069
10682	centrality_logp	-3940
10682	type	ChIP-seq
10682	source	ENCODE
10683	medline	8065305
10683	tax_group	vertebrates
10683	class	Zinc-coordinating
10683	family	BetaBetaAlpha-zinc finger
10683	pazar_tf_id	TF0000074
10683	centrality_logp	-714
10683	type	ChIP-seq
10683	source	ENCODE
9378	description	GA binding protein transcription factor,alpha subunit 60kDa
9370	description	POU class 5 homeobox 1
9367	description	CCCTC-binding factor (zinc finger protein)
10685	medline	22895281
10685	tax_group	insects
10685	class	Zinc-coordinating
10685	family	BED
10685	type	ChIP-chip
10686	medline	2571934
10686	tax_group	insects
10686	class	Helix-Turn-Helix
10686	family	Homeo
10686	pazar_tf_id	-
10686	type	ChIP-chip
10687	medline	10952900
10687	tax_group	insects
10687	class	Zipper-Type
10687	family	Leucine Zipper
10687	type	ChIP-chip
10688	medline	17616980
10688	tax_group	insects
10688	class	Zinc-coordinating
10688	family	BetaBetaAlpha-zinc finger
10688	type	ChIP-chip
10689	medline	18332042
10689	tax_group	insects
10689	class	Zinc-coordinating
10689	family	BetaBetaAlpha-zinc finger
10689	pazar_tf_id	-
10689	type	ChIP-chip
10690	medline	8608596
10690	tax_group	insects
10690	class	Ig-fold
10690	family	Stat
10690	type	ChIP-chip
10691	medline	17705839
10691	tax_group	insects
10691	class	Zinc-coordinating
10691	family	BetaBetaAlpha-zinc finger
10691	type	ChIP-chip
10692	medline	8649409
10692	tax_group	insects
10692	class	Zinc-coordinating
10692	family	Hormone-nuclear Receptor
10692	type	ChIP-Seq
10693	medline	9118222
10693	tax_group	insects
10693	class	Other Alpha-Helix
10693	family	High Mobility Group
10693	pazar_tf_id	-
10693	type	ChIP-chip
10694	medline	15572468
10694	tax_group	insects
10694	class	Zinc-coordinating
10694	family	MH1
10694	type	ChIP-chip
10695	medline	9367990
10695	tax_group	insects
10695	class	Zinc-coordinating
10695	family	GATA
10695	type	ChIP-chip
10696	medline	18585360
10696	tax_group	insects
10696	class	Helix-Turn-Helix
10696	family	Homeo
10696	pazar_tf_id	-
10696	type	ChIP-chip
10697	medline	20421211
10697	tax_group	nematodes
10697	class	Zinc-coordinating
10697	family	BetaBetaAlpha-zinc finger
10697	type	ChIP-seq
10697	comment	C. elegans blmp-1 is the homologue of mammalian Blimp1 (B Lymphocyte-Induced Maturation Protein-1, official name: PRDM1).
10698	medline	15375261
10698	tax_group	nematodes
10698	class	Zinc-coordinating
10698	family	Hormone-nuclear Receptor
10698	type	ChIP-seq
10699	medline	17293863
10699	tax_group	nematodes
10699	class	Hinge
10699	family	SMC
10699	type	ChIP-seq
10700	medline	11463372
10700	tax_group	nematodes
10700	class	Winged Helix-Turn-Helix
10700	family	E2F
10700	type	ChIP-seq
10701	medline	18662544
10701	tax_group	nematodes
10701	class	Zinc-coordinating
10701	family	GATA
10701	type	ChIP-seq
10702	medline	15355793
10702	tax_group	nematodes
10702	class	Zinc-coordinating
10702	family	BetaBetaAlpha-zinc finger
10702	type	ChIP-seq
10703	medline	22345127
10703	tax_group	nematodes
10703	class	Helix-Turn-Helix
10703	family	Myb
10703	type	ChIP-seq
10704	medline	1338434, 7939715
10704	tax_group	nematodes
10704	class	Zipper-Type
10704	family	Helix-Loop-Helix
10704	type	ChIP-seq
10705	medline	20623595
10705	tax_group	nematodes
10705	class	Winged Helix-Turn-Helix
10705	family	Forkhead
10705	type	ChIP-seq
10706	medline	23555279
10706	tax_group	nematodes
10706	class	Zipper-Type
10706	family	Leucine Zipper
10706	type	ChIP-seq
10707	medline	12743119
10707	tax_group	plants
10707	class	Other Alpha-Helix
10707	family	MADS
10707	type	ChIP-chip
10708	medline	15680330
10708	tax_group	plants
10708	class	Zipper-Type
10708	family	Helix-Loop-Helix
10708	type	ChIP-chip
10709	medline	15681342
10709	tax_group	plants
10709	class	Zipper-Type
10709	family	Helix-Loop-Helix
10709	type	ChIP-chip
10710	medline	18287490
10710	tax_group	plants
10710	class	Zipper-Type
10710	family	Leucine Zipper
10710	type	ChIP-chip
10711	medline	15448264
10711	tax_group	plants
10711	class	Zipper-Type
10711	family	Helix-Loop-Helix
10711	type	ChIP-chip
10712	medline	unpublished
10712	tax_group	plants
10712	class	AP2-ERF
10712	family	AP2-ERF
10712	type	ChIP-chip
10713	medline	8774892
10713	tax_group	plants
10713	class	Other Alpha-Helix
10713	family	MADS
10713	type	ChIP-chip
10714	medline	8774892
10714	tax_group	plants
10714	class	Other Alpha-Helix
10714	family	MADS
10714	type	ChIP-chip
10715	medline	8774892
10715	tax_group	plants
10715	class	Other Alpha-Helix
10715	family	MADS
10715	type	ChIP-seq
10716	medline	21803941
10716	tax_group	plants
10716	class	-
10716	family	-
10716	type	ChIP-seq
10717	medline	21464308
10717	tax_group	plants
10717	class	Other Alpha-Helix
10717	family	MADS
10717	type	ChIP-seq
10718	medline	8774892
10718	tax_group	plants
10718	class	Other Alpha-Helix
10718	family	MADS
10718	type	ChIP-seq
10719	medline	10797009
10719	tax_group	plants
10719	class	Zipper-Type
10719	family	Helix-Loop-Helix
10719	type	ChIP-seq
10720	medline	22536829
10720	tax_group	plants
10720	class	Zipper-Type
10720	family	Helix-Loop-Helix
10720	type	ChIP-seq
10721	medline	22536829
10721	tax_group	plants
10721	class	Zipper-Type
10721	family	Helix-Loop-Helix
10721	type	ChIP-seq
10722	medline	19033361
10722	tax_group	plants
10722	class	Other Alpha-Helix
10722	family	MADS
10722	type	ChIP-seq
10723	medline	unpublished
10723	tax_group	plants
10723	class	EcoRII fold
10723	family	ABI3VP1
10723	type	PBM
10724	medline	unpublished
10724	tax_group	plants
10724	class	EcoRII fold
10724	family	ABI3VP1
10724	type	PBM
10725	medline	21284757
10725	tax_group	plants
10725	class	Zipper-Type
10725	family	Helix-Loop-Helix
10725	type	PBM
10726	medline	21284757
10726	tax_group	plants
10726	class	Beta-Hairpin-Ribbon
10726	family	AP2 MBD-like
10726	type	PBM
10727	medline	21335373
10727	tax_group	plants
10727	class	Zipper-Type
10727	family	Helix-Loop-Helix
10727	type	PBM
10728	medline	21335373
10728	tax_group	plants
10728	class	Zipper-Type
10728	family	Helix-Loop-Helix
10728	type	PBM
10729	medline	10636868
10729	tax_group	plants
10729	class	Zipper-Type
10729	family	Leucine Zipper
10729	type	SELEX
10730	medline	7901838
10730	tax_group	plants
10730	class	Other Alpha-Helix
10730	family	MADS
10730	pazar_tf_id	-
10730	type	SELEX
10731	medline	11058102
10731	tax_group	plants
10731	class	Beta-Hairpin-Ribbon
10731	family	AP2 MBD-like
10731	type	SELEX
10732	medline	8253077
10732	tax_group	plants
10732	class	Helix-Turn-Helix
10732	family	Homeo
10732	type	SELEX
10733	medline	11247607
10733	tax_group	plants
10733	class	Helix-Turn-Helix
10733	family	Homeo
10733	pazar_tf_id	-
10733	type	SELEX
10734	medline	9747806
10734	tax_group	plants
10734	class	Helix-Turn-Helix
10734	family	Homeo
10734	type	SELEX
10735	medline	9628022
10735	tax_group	plants
10735	class	Helix-Turn-Helix
10735	family	Myb
10735	type	SELEX
10736	medline	9628022
10736	tax_group	plants
10736	class	Helix-Turn-Helix
10736	family	Myb
10736	type	SELEX
10737	medline	9628022
10737	tax_group	plants
10737	class	Helix-Turn-Helix
10737	family	Myb
10737	type	SELEX
10738	medline	16095614
10738	tax_group	plants
10738	class	Zinc-coordinating
10738	family	SBP
10738	type	SELEX
10739	medline	16095614
10739	tax_group	plants
10739	class	Zinc-coordinating
10739	family	SBP
10739	type	SELEX
10740	medline	8917598
10740	tax_group	plants
10740	class	Helix-Turn-Helix
10740	family	Myb
10740	type	SELEX
10741	medline	22775442
10741	tax_group	plants
10741	class	Zipper-Type
10741	family	Helix-Loop-Helix
10741	type	SELEX
10742	medline	unpublished
10742	tax_group	plants
10742	class	EcoRII fold
10742	family	ABI3VP1
10742	type	SELEX
10743	medline	9862967
10743	tax_group	plants
10743	class	Beta-Hairpin-Ribbon
10743	family	AP2 MBD-like
10743	type	SELEX
10744	medline	9862967
10744	tax_group	plants
10744	class	EcoRII fold
10744	family	ABI3VP1
10744	type	SELEX
10745	medline	8597661
10745	tax_group	plants
10745	class	Other Alpha-Helix
10745	family	MADS
10745	type	SELEX
10746	medline	8597661
10746	tax_group	plants
10746	class	Other Alpha-Helix
10746	family	MADS
10746	pazar_tf_id	-
10746	type	SELEX
10747	medline	8597661
10747	tax_group	plants
10747	class	Other Alpha-Helix
10747	family	MADS
10747	type	SELEX
10748	medline	18302343
10748	tax_group	plants
10748	class	Zinc-coordinating
10748	family	SBP
10748	type	SELEX
10749	medline	22074922
10749	tax_group	plants
10749	class	Zipper-Type
10749	family	Helix-Loop-Helix
10749	type	SELEX
10750	medline	1446171
10750	tax_group	plants
10750	class	Zipper-Type
10750	family	Leucine Zipper
10750	type	SELEX
10751	medline	8972846
10751	tax_group	plants
10751	class	-
10751	family	WRKY
10751	type	SELEX
10752	medline	21515819
10752	tax_group	plants
10752	class	Helix-Turn-Helix
10752	family	LEAFY
10752	type	SELEX
9230	tfe_id	599
9232	tfe_id	580
9234	tfe_id	580, 577
9235	tfe_id	191
9237	tfe_id	855
9242	tfe_id	790
9246	tfe_id	125
9252	tfe_id	131
9255	tfe_id	636
9258	tfe_id	427
9260	tfe_id	418
9261	tfe_id	435
9263	tfe_id	187
9267	tfe_id	712
9270	tfe_id	429
9275	tfe_id	167
9278	tfe_id	539
9280	tfe_id	145
9291	tfe_id	776
9293	tfe_id	336, 343
9294	tfe_id	336
9295	tfe_id	788
9297	tfe_id	506
9299	tfe_id	340
9300	tfe_id	340
9302	tfe_id	343, 348
9303	tfe_id	821
9305	tfe_id	494
9306	tfe_id	833
9307	tfe_id	841
9308	tfe_id	518
9309	tfe_id	529
9311	tfe_id	153
9315	tfe_id	838
9318	tfe_id	188
9320	tfe_id	665, 877
9326	tfe_id	912
9327	tfe_id	646
9328	tfe_id	749
9332	tfe_id	781
9340	tfe_id	966
9341	tfe_id	138
9342	tfe_id	375, 325
9343	tfe_id	140
9344	tfe_id	314, 343
9348	tfe_id	520, 195
9351	tfe_id	592
9353	tfe_id	528
9361	tfe_id	797
9363	tfe_id	720
9365	tfe_id	148
9368	tfe_id	186
9369	tfe_id	134
9370	tfe_id	810
9371	tfe_id	531
9372	tfe_id	149
9375	tfe_id	752
9376	tfe_id	175
9379	tfe_id	187
9380	tfe_id	712
9382	tfe_id	599
9383	tfe_id	148
9384	tfe_id	781
9385	tfe_id	167
9386	tfe_id	138
9387	tfe_id	336, 343
9388	tfe_id	118
9389	tfe_id	619
9390	tfe_id	763
9391	tfe_id	544, 867
9392	tfe_id	622
9393	tfe_id	548
9395	tfe_id	478, 443
9396	tfe_id	682
9397	tfe_id	337
9398	tfe_id	378, 328
9399	tfe_id	195
9400	tfe_id	623
9402	tfe_id	371
9403	tfe_id	518
9404	tfe_id	125
9405	tfe_id	646
9406	tfe_id	841
9502	tfe_id	139
9503	tfe_id	1033, 537
10526	tfe_id	496, 497
10580	tfe_id	141
10576	tfe_id	358
10577	tfe_id	136
10639	tfe_id	851, 852
10638	tfe_id	850
10637	tfe_id	148
10635	tfe_id	839
10634	tfe_id	836
10632	tfe_id	393
10629	tfe_id	819
10625	tfe_id	381
10624	tfe_id	320
10623	tfe_id	776
10620	tfe_id	756
10619	tfe_id	755
10616	tfe_id	143
10615	tfe_id	141
10614	tfe_id	365, 315
10613	tfe_id	710
10604	tfe_id	310
10602	tfe_id	652
10601	tfe_id	445
10600	tfe_id	477
10599	tfe_id	174
10597	tfe_id	512
10592	tfe_id	624
10591	tfe_id	136
10590	tfe_id	134
10589	tfe_id	620
10587	tfe_id	612
10585	tfe_id	526
10584	tfe_id	854
10583	tfe_id	595
10582	tfe_id	124
10581	tfe_id	587
10640	tfe_id	853
10641	tfe_id	864
10642	tfe_id	871
10649	tfe_id	191
10651	tfe_id	131
10652	tfe_id	622
10653	tfe_id	623
10655	tfe_id	139
10656	tfe_id	912
10657	tfe_id	175
10658	tfe_id	187
10661	tfe_id	140
10662	tfe_id	539
10664	tfe_id	145
10665	tfe_id	749
10666	tfe_id	752
10667	tfe_id	781
10668	tfe_id	118
10671	tfe_id	790
10672	tfe_id	518
10673	tfe_id	531
10674	tfe_id	841
10675	tfe_id	153
10676	tfe_id	148
10677	tfe_id	149
10678	tfe_id	186
9277	tfbs_shape_id	52
9276	tfbs_shape_id	51
9274	tfbs_shape_id	49
9273	tfbs_shape_id	48
9272	tfbs_shape_id	47
9271	tfbs_shape_id	46
9269	tfbs_shape_id	45
9268	tfbs_shape_id	44
9266	tfbs_shape_id	42
9262	tfbs_shape_id	39
9259	tfbs_shape_id	38
9258	tfbs_shape_id	37
9257	tfbs_shape_id	36
9256	tfbs_shape_id	35
9255	tfbs_shape_id	34
9254	tfbs_shape_id	33
9253	tfbs_shape_id	32
9251	tfbs_shape_id	30
9250	tfbs_shape_id	29
9249	tfbs_shape_id	28
9248	tfbs_shape_id	27
9247	tfbs_shape_id	26
9245	tfbs_shape_id	24
9244	tfbs_shape_id	23
9243	tfbs_shape_id	22
9241	tfbs_shape_id	20
9240	tfbs_shape_id	19
9239	tfbs_shape_id	18
9238	tfbs_shape_id	17
9237	tfbs_shape_id	16
9236	tfbs_shape_id	15
9234	tfbs_shape_id	13
9233	tfbs_shape_id	12
9232	tfbs_shape_id	11
9229	tfbs_shape_id	10
10666	tfbs_shape_id	140
10667	tfbs_shape_id	262
10668	tfbs_shape_id	143
10669	tfbs_shape_id	103
10670	tfbs_shape_id	61
10671	tfbs_shape_id	21
10672	tfbs_shape_id	80
10674	tfbs_shape_id	79
10675	tfbs_shape_id	83
10677	tfbs_shape_id	137
10678	tfbs_shape_id	263
10679	tfbs_shape_id	264
10680	tfbs_shape_id	104
10681	tfbs_shape_id	92
10682	tfbs_shape_id	94
10683	tfbs_shape_id	101
10685	tfbs_shape_id	329
10686	tfbs_shape_id	198
10687	tfbs_shape_id	330
10688	tfbs_shape_id	331
10689	tfbs_shape_id	249
10690	tfbs_shape_id	332
10691	tfbs_shape_id	333
10692	tfbs_shape_id	334
10693	tfbs_shape_id	216
10694	tfbs_shape_id	335
10695	tfbs_shape_id	336
10696	tfbs_shape_id	226
10697	tfbs_shape_id	337
10698	tfbs_shape_id	338
10699	tfbs_shape_id	339
10700	tfbs_shape_id	340
10701	tfbs_shape_id	341
10702	tfbs_shape_id	342
10703	tfbs_shape_id	343
10704	tfbs_shape_id	344
10705	tfbs_shape_id	345
10706	tfbs_shape_id	346
10707	tfbs_shape_id	347
10708	tfbs_shape_id	348
10709	tfbs_shape_id	349
10711	tfbs_shape_id	351
10712	tfbs_shape_id	352
10713	tfbs_shape_id	353
10714	tfbs_shape_id	354
10715	tfbs_shape_id	355
10717	tfbs_shape_id	356
10718	tfbs_shape_id	357
10719	tfbs_shape_id	358
10720	tfbs_shape_id	359
10721	tfbs_shape_id	360
10722	tfbs_shape_id	361
9364	description	E74-like factor 5 (ets domain transcription factor)
9363	description	LIM homeobox 3
9362	description	breast cancer 1,early onset
9361	description	pancreatic and duodenal homeobox 1
9360	description	MIZF
9359	description	zinc finger protein 354C
9354	description	NOBOX oogenesis homeobox
9353	description	NK3 homeobox 1
9351	description	NK3 homeobox 2
9348	description	-
9346	description	v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog B
9345	description	
9344	description	-
9342	description	nuclear receptor subfamily 3,group C,member 1 (glucocorticoid receptor)
9340	description	spermatogenic leucine zipper 1
9338	description	helicase-like transcription factor
9337	description	TATA box binding protein
9335	description	v-rel avian reticuloendotheliosis viral oncogene homolog A
9333	description	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
9329	description	v-rel avian reticuloendotheliosis viral oncogene homolog
9320	description	-
9319	description	-
9318	description	TEA domain family member 1 (SV40 transcriptional enhancer factor)
9317	description	-
9316	description	zinc finger protein 143
9315	description	SRY (sex determining region Y)-box 5
9312	description	sex determining region Y
9309	description	Spi-B transcription factor (Spi-1/PU.1 related)
9306	description	SRY (sex determining region Y)-box 17
9305	description	SRY (sex determining region Y)-box 9
9303	description	paired related homeobox 2
9302	description	-
9301	description	ras responsive element binding protein 1
9300	description	RAR-related orphan receptor A
9299	description	RAR-related orphan receptor A
9298	description	pre-B-cell leukemia homeobox 1
9297	description	paired box 6
9296	description	paired box 4
9295	description	paired box 2
9294	description	peroxisome proliferator-activated receptor gamma
9291	description	NK2 homeobox 5
9287	description	-
9285	description	myeloid zinc finger 1 ZNF42
9284	description	myeloid zinc finger 1 ZNF42
9279	description	interferon regulatory factor 2
9276	description	nescient helix loop helix 1
9274	description	HNF1 homeobox A
9271	description	hepatic leukemia factor
9270	description	forkhead box I1
9269	description	forkhead box D3
9268	description	forkhead box Q1
9266	description	growth factor independent 1 transcription repressor ZNF163
9261	description	forkhead box L1
9260	description	forkhead box C1
9259	description	forkhead box D1
9258	description	forkhead box F2
9257	description	MDS1 and EVI1 complex locus MDS1,EVI1
9256	description	ELK1,member of ETS oncogene family
9255	description	engrailed homeobox 1
9253	description	nuclear factor,interleukin 3 regulated
9247	description	-
9245	description	nuclear receptor subfamily 2,group F,member 1
9237	description	T,brachyury homolog (mouse)
9234	description	-
9232	description	aryl hydrocarbon receptor nuclear translocator
10683	symbol	ZEB1
10682	symbol	YY1
10681	symbol	USF1
10680	symbol	TP53
10679	symbol	TFAP2A
10678	symbol	-
10677	symbol	STAT3
10676	symbol	STAT1
10675	symbol	SRF
10674	symbol	SP1
10673	symbol	SOX2
10672	symbol	SPI1
10671	symbol	PAX5
10670	symbol	NFYA
10668	symbol	NFE2L2
10667	symbol	MYCN
10666	symbol	MYC
10665	symbol	MYB
10664	symbol	MEF2A
10663	symbol	MAX
10662	symbol	IRF1
10661	symbol	HNF4A
10660	symbol	GATA3
10659	symbol	GATA2
10658	symbol	GATA1
10657	symbol	FOXA1
10656	symbol	ETS1
10655	symbol	ESR2
10654	symbol	ELK4
10653	symbol	EGR1
10652	symbol	EBF1
10651	symbol	E2F1
10650	symbol	CEBPA
10649	symbol	AR
10648	symbol	ZNF263
10647	symbol	ZBTB33
10646	symbol	USF2
10645	symbol	TP63
10644	symbol	TFAP2C
10643	symbol	TCF7L2
10642	symbol	TCF3
10641	symbol	TCF12
10640	symbol	STAT6
10581	symbol	ATOH1
10582	symbol	-
10583	symbol	BCL6
10584	symbol	BHLHE40
10585	symbol	CDX2
10586	symbol	CEBPB
10587	symbol	CRX
10588	symbol	DUX4
10589	symbol	E2F3
10590	symbol	E2F4
10591	symbol	E2F6
10592	symbol	EGR2
10593	symbol	ELF1
10594	symbol	ERG
10595	symbol	FLI1
10596	symbol	FOS
10597	symbol	FOSL1
10598	symbol	FOSL2
10599	symbol	FOXH1
10600	symbol	FOXO1
10601	symbol	FOXP1
10602	symbol	GATA4
10603	symbol	GFI1B
10604	symbol	HNF4G
10605	symbol	HOXC9
10606	symbol	HSF1
10608	symbol	JUN
10609	symbol	JUN
10610	symbol	JUNB
10611	symbol	JUND
10612	symbol	JUND
10613	symbol	KLF1
10614	symbol	-
10615	symbol	MAFF
10616	symbol	MAFK
10617	symbol	MEF2C
10618	symbol	MEIS1
10619	symbol	MYOD1
10620	symbol	MYOG
10621	symbol	-
10622	symbol	NFYB
10623	symbol	NKX2-5
10624	symbol	NR2C2
10625	symbol	NR5A2
10626	symbol	NRF1
10627	symbol	POU2F2
10628	symbol	PRDM1
10629	symbol	RFX1
10630	symbol	RFX5
10631	symbol	RUNX2
10632	symbol	RXRA
10633	symbol	-
10634	symbol	SOX3
10635	symbol	SOX6
10636	symbol	SP2
10637	symbol	-
10638	symbol	STAT4
10639	symbol	-
10576	symbol	18555785
10579	symbol	18555785
10578	symbol	18555785
10526	symbol	SOX10
9503	symbol	-
9405	symbol	-
9404	symbol	CREB1
9402	symbol	NR2E3
9401	symbol	PLAG1
9399	symbol	NFIC
9398	symbol	NR4A2
9397	symbol	-
9396	symbol	HOXA5
9395	symbol	FOXO3
9394	symbol	FEV
9393	symbol	INSM1
9391	symbol	HNF1B
9390	symbol	NFATC2
9389	symbol	ARID3A
9387	symbol	-
9386	symbol	ESR1
9385	symbol	FOXA2
9382	symbol	RUNX1
9381	symbol	REST
9380	symbol	KLF4
9378	symbol	GABPA
9377	symbol	-
9370	symbol	POU5F1
9367	symbol	CTCF
9364	symbol	ELF5
9363	symbol	LHX3
9362	symbol	BRCA1
9361	symbol	PDX1
9360	symbol	histone H4 transcription factor
9359	symbol	ZNF354C
9354	symbol	NOBOX
9353	symbol	NKX3-1
9351	symbol	NKX3-2
9348	symbol	-
9346	symbol	MAFB
9345	symbol	zinc finger protein 423
9344	symbol	-
9342	symbol	NR3C1
9340	symbol	SPZ1
9338	symbol	HLTF
9337	symbol	TBP
9335	symbol	RELA
9333	symbol	NFKB1
9329	symbol	REL
9320	symbol	-
9319	symbol	-
9318	symbol	TEAD1
9317	symbol	-
9316	symbol	ZNF143
9315	symbol	SOX5
9312	symbol	SRY
9309	symbol	SPIB
9306	symbol	SOX17
9305	symbol	SOX9
9303	symbol	PRRX2
9302	symbol	-
9301	symbol	RREB1
9300	symbol	RORA
9299	symbol	RORA
9298	symbol	PBX1
9297	symbol	PAX6
9296	symbol	PAX4
9295	symbol	PAX2
9294	symbol	PPARG
9291	symbol	NKX2-5
9287	symbol	-
9284	symbol	MZF1
9285	symbol	MZF1
9279	symbol	IRF2
9276	symbol	NHLH1
9271	symbol	HLF
9274	symbol	HNF1A
9270	symbol	FOXI1
9269	symbol	FOXD3
9268	symbol	FOXQ1
9266	symbol	GFI1
9261	symbol	FOXL1
9260	symbol	FOXC1
9259	symbol	FOXD1
9258	symbol	FOXF2
9257	symbol	MECOM
9255	symbol	EN1
9256	symbol	ELK1
9253	symbol	NFIL3
9247	symbol	-
9245	symbol	NR2F1
9237	symbol	T
9234	symbol	-
9232	symbol	ARNT
10683	alias	BZP,ZEB,AREB6,NIL-2-A,Zfhep,Zfhx1a
10682	alias	NF-E1,DELTA,UCRBP,YIN-YANG-1,INO80S
10681	alias	UEF,MLTFI,bHLHb11
10680	alias	p53,LFS1
10679	alias	AP-2
10677	alias	APRF
10678	alias	-
10676	alias	STAT91,ISGF-3
10675	alias	MCM1
10674	alias	-
10673	alias	-
10672	alias	PU.1,SPI-A,OF,SFPI1,SPI-1
10671	alias	BSAP
10670	alias	HAP2,CBF-B,NF-YA
10668	alias	NRF2
10667	alias	bHLHe37,N-myc,MYCNOT
10666	alias	c-Myc,bHLHe39,MYCC
10665	alias	c-myb
10664	alias	RSRFC4,RSRFC9
10663	alias	bHLHd4,bHLHd5,bHLHd6,bHLHd7,bHLHd8
10662	alias	MAR
10661	alias	NR2A1,HNF4
10660	alias	HDR
10659	alias	NFE1B
10658	alias	ERYF1,NFE1,GATA-1,NF-E1
10656	alias	FLJ10768,ETS-1
10657	alias	-
10654	alias	SAP1
10655	alias	NR3A2,Erb
10653	alias	TIS8,G0S30,NGFI-A,KROX-24,ZIF-268,AT225,ZNF225
10652	alias	OLF1
10651	alias	RBP3
10650	alias	C/EBP-alpha
10649	alias	AIS,NR3C4,SMAX1,HUMARA
10648	alias	FPM315,ZKSCAN12,ZSCAN44
10647	alias	ZNF-kaiso,kaiso,WUGSC:H_DJ525N14.1,KAISO,ZNF348
10646	alias	FIP,bHLHb12
10645	alias	p51,SHFM4,EEC3,p63,p73L,OFC8,KET,p73H,NBP,p53CP
10644	alias	AP2-GAMMA,ERF1,TFAP2G,hAP-2g
10643	alias	TCF-4
10642	alias	E2A,ITF1,MGC129647,MGC129648,bHLHb21,VDIR,E47
10641	alias	HEB,HTF4,HsT17266,bHLHb20
10640	alias	D12S1644,IL-4-STAT
10581	alias	HATH1,MATH-1,Math1,bHLHa14
10582	alias	-
10584	alias	DEC1,bHLHe40
10583	alias	ZBTB27,LAZ3,BCL5,BCL6A
10585	alias	-
10586	alias	LAP,CRP2,NFIL6,IL6DBP,C/EBP-beta
10587	alias	CRD,LCA7,OTX3
10588	alias	-
10589	alias	-
10590	alias	E2F-4
10592	alias	-
10591	alias	E2F-6
10594	alias	erg-3,p55
10593	alias	-
10595	alias	SIC-1,EWSR2
10596	alias	c-fos,AP-1
10597	alias	fra-1
10598	alias	FRA2,FLJ23306
10599	alias	FAST1
10600	alias	FKH1
10601	alias	QRF1,12CC4,HSPC215,hFKH1B
10603	alias	-
10602	alias	-
10604	alias	NR2A2
10606	alias	HSTF1
10605	alias	-
10608	alias	c-Jun,AP-1
10609	alias	c-Jun,AP-1
10610	alias	-
10611	alias	AP-1
10612	alias	AP-1
10613	alias	EKLF
10614	alias	-
10616	alias	P18,NFE2U
10615	alias	hMafF
10617	alias	-
10618	alias	-
10619	alias	PUM,MYOD,bHLHc1
10620	alias	bHLHc3
10621	alias	-
10622	alias	CBF-A,HAP3,NF-YB
10623	alias	CSX1,NKX2.5,NKX4-1
10624	alias	TAK1,TR2R1,hTAK1
10626	alias	EWG,ALPHA-PAL
10625	alias	FTZ-F1beta,hB1F,LRH-1,FTZ-F1,hB1F-2,B1F2
10627	alias	OCT2
10628	alias	PRDI-BF1
10629	alias	EF-C
10630	alias	-
10632	alias	NR2B1
10631	alias	AML3,PEBP2A1,PEBP2aA1
10633	alias	-
10634	alias	-
10635	alias	-
10636	alias	KIAA0048
10637	alias	-
10638	alias	-
10639	alias	-
10579	alias	ZFX
10576	alias	ESRRB
10578	alias	TFCP2L1
10526	alias	DOM,WS4,WS2E
9503	alias	-
9405	alias	-
9404	alias	-
9402	alias	PNR,rd7,RP37
9401	alias	ZNF912
9399	alias	CTF,NF-I,CTF5
9398	alias	TINUR,NOT,RNR1,HZF-3
9397	alias	-
9396	alias	-
9394	alias	Pet-1
9395	alias	AF6q21,FOXO2
9393	alias	IA-1,IA1
9391	alias	LFB3,VHNF1,HNF1beta,MODY5
9390	alias	NF-ATP,NFATp,NFAT1
9389	alias	BRIGHT
9387	alias	-
9385	alias	-
9386	alias	NR3A1,Era
9382	alias	PEBP2A2,AMLCR1
9380	alias	EZF,GKLF
9381	alias	NRSF,XBR
9378	alias	E4TF1A,NFT2,NRF2,E4TF1-60,NRF2A
9377	alias	-
9370	alias	OCT3,Oct4,MGC22487
9364	alias	-
9367	alias	-
9363	alias	-
9362	alias	RNF53,BRCC1,PPP1R53
9361	alias	IDX-1,STF-1,PDX-1,MODY4
9360	alias	DKFZP434F162,HiNF-P,ZNF743,MIZF
9359	alias	KID3
9354	alias	OG2,Og2x
9353	alias	NKX3.1,BAPX2
9351	alias	NKX3B,NKX3.2
9346	alias	-
9348	alias	-
9345	alias	KIAA0760,OAZ,Roaz,Ebfaz,Zfp104,NPHP14
9344	alias	-
9340	alias	NYD-TSP1,FLJ25709
9342	alias	GR
9337	alias	TFIID
9338	alias	HIP116A,HLTF1,RNF80
9335	alias	p65
9333	alias	KBF1,p105,NFKB-p50,p50,NF-kappaB,NFkappaB,NF-kB1
9329	alias	I-Rel,c-Rel
9320	alias	-
9319	alias	-
9317	alias	-
9318	alias	TEF-1
9316	alias	SBF,pHZ-1,STAF
9315	alias	L-SOX5,MGC35153
9312	alias	TDF
9306	alias	-
9309	alias	SPI-B
9305	alias	SRA1
9302	alias	-
9303	alias	PRX2,PMX2
9301	alias	HNT
9300	alias	RZRA,ROR1,ROR2,ROR3,NR1F1
9299	alias	RZRA,ROR1,ROR2,ROR3,NR1F1
9298	alias	-
9297	alias	D11S812E,AN,WAGR
9296	alias	MODY9
9295	alias	-
9294	alias	PPARG1,PPARG2,NR1C3,PPARgamma
9287	alias	-
9291	alias	CSX1,NKX2.5,NKX4-1
9285	alias	ZSCAN6,MZF1B,MZF-1,Zfp98
9279	alias	-
9284	alias	ZSCAN6,MZF1B,MZF-1,Zfp98
9276	alias	NSCL,NSCL1,bHLHa35
9274	alias	HNF1,LFB1
9271	alias	MGC33822
9269	alias	Genesis,HFH2
9270	alias	FREAC6
9268	alias	HFH1
9266	alias	GFI1A,GFI-1
9260	alias	FREAC3,ARA,IGDA,IHG1
9261	alias	FREAC7,FKH6
9258	alias	FREAC2
9259	alias	FREAC4
9256	alias	-
9257	alias	MDS1-EVI1,PRDM3
9255	alias	-
9247	alias	-
9253	alias	E4BP4,NFIL3A,NF-IL3A
9245	alias	EAR-3,COUP-TFI,TCFCOUP1,SVP44
9237	alias	-
9234	alias	-
9232	alias	HIF-1beta,bHLHe2
10620	description	myogenin (myogenic factor 4)
10619	description	myogenic differentiation 1
10618	description	Meis homeobox 1
10617	description	myocyte enhancer factor 2C
10616	description	v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog K
10615	description	v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog F
10614	description	-
10613	description	Kruppel-like factor 1 (erythroid)
10612	description	jun D proto-oncogene
10611	description	jun D proto-oncogene
10610	description	jun B proto-oncogene
10609	description	jun proto-oncogene
10608	description	jun proto-oncogene
10606	description	heat shock transcription factor 1
10605	description	homeobox C9
10604	description	hepatocyte nuclear factor 4,gamma
10603	description	growth factor independent 1B transcription repressor
10602	description	GATA binding protein 4
10601	description	forkhead box P1
10600	description	forkhead box O1
10599	description	forkhead box H1
10598	description	FOS-like antigen 2
10597	description	FOS-like antigen 1
10596	description	FBJ murine osteosarcoma viral oncogene homolog
10595	description	Fli-1 proto-oncogene,ETS transcription factor
10594	description	v-ets avian erythroblastosis virus E26 oncogene homolog
10593	description	E74-like factor 1 (ets domain transcription factor)
10592	description	early growth response 2
10591	description	E2F transcription factor 6
10590	description	E2F transcription factor 4,p107/p130-binding
10589	description	E2F transcription factor 3
10588	description	double homeobox 4
10587	description	cone-rod homeobox
10586	description	CCAAT/enhancer binding protein (C/EBP),beta
10585	description	caudal type homeobox 2
10584	description	basic helix-loop-helix family,member e40
10583	description	B-cell CLL/lymphoma 6
10582	description	-
10581	description	atonal homolog 1 (Drosophila)
10640	description	signal transducer and activator of transcription 6,interleukin-4 induced
10641	description	transcription factor 12
10642	description	transcription factor 3
10643	description	transcription factor 7-like 2 (T-cell specific,HMG-box)
10644	description	transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)
10645	description	tumor protein p63
10646	description	upstream transcription factor 2,c-fos interacting
10647	description	zinc finger and BTB domain containing 33
10648	description	zinc finger protein 263
10649	description	androgen receptor
10650	description	CCAAT/enhancer binding protein (C/EBP),alpha
10651	description	E2F transcription factor 1
10652	description	early B-cell factor 1
10653	description	early growth response 1
10654	description	ELK4,ETS-domain protein (SRF accessory protein 1)
10655	description	estrogen receptor 2 (ER beta)
10656	description	v-ets avian erythroblastosis virus E26 oncogene homolog 1
10657	description	forkhead box A1
10658	description	GATA binding protein 1 (globin transcription factor 1)
10659	description	GATA binding protein 2
10660	description	GATA binding protein 3
10661	description	hepatocyte nuclear factor 4,alpha
10662	description	interferon regulatory factor 1
10663	description	MYC associated factor X
10664	description	myocyte enhancer factor 2A
10665	description	v-myb avian myeloblastosis viral oncogene homolog
10666	description	v-myc avian myelocytomatosis viral oncogene homolog
10667	description	v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog
10668	description	nuclear factor,erythroid 2-like 2
10670	description	nuclear transcription factor Y,alpha
10671	description	paired box 5
10672	description	spleen focus forming virus (SFFV) proviral integration oncogene
10673	description	SRY (sex determining region Y)-box 2
10674	description	Sp1 transcription factor
10675	description	serum response factor (c-fos serum response element-binding transcription factor)
10676	description	signal transducer and activator of transcription 1,91kDa
10677	description	signal transducer and activator of transcription 3 (acute-phase response factor)
10678	description	-
10679	description	transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)
10680	description	tumor protein p53
10681	description	upstream transcription factor 1
10682	description	YY1 transcription factor
10683	description	zinc finger E-box binding homeobox 1
9369	centrality_logp	358
9369	symbol	18555785
9369	source	ChiP-seq
9373	tfe_id	138
9373	symbol	18555785
9373	source	ChiP-seq
9374	source	ChiP-seq
9374	tfe_id	139
9374	symbol	18555785
10576	source	ChiP-seq
10576	centrality_logp	358
10577	source	ChiP-seq
10577	centrality_logp	531
10577	symbol	18555785
10578	source	ChiP-seq
10579	source	ChiP-seq
10580	centrality_logp	175
10580	symbol	18798982
10580	source	ChiP-Seq
10753	medline	11069897
10753	source	PAZAR
10753	family	Leucine-Zipper
10753	type	ChiP-seq
10753	class	Zipper-Type
10753	centrality_logp	-74.11
10753	tax_group	vertebrates
10754	description	estrogen-related receptor alpha
10754	centrality_logp	-159.04
10754	tax_group	vertebrates
10754	alias	NR3B1,ESRL1,ERRalpha,ERRa,ERR1
10754	tfe_id	307
10754	symbol	ESRRA
10754	medline	17488637
10754	source	ENCODE
10754	family	Hormone-nuclear Receptor
10754	type	ChiP-seq
10754	class	Zinc-coordinating
10755	family	Forkhead
10755	type	ChiP-seq
10755	class	Winged Helix-Turn-Helix
10755	description	forkhead box P2
10755	centrality_logp	-51.6
10755	tax_group	vertebrates
10755	alias	TNRC10,SPCH1,CAGH44
10755	tfe_id	446
10755	symbol	FOXP2
10755	medline	23625967
10755	source	ENCODE
10756	medline	12923056
10756	source	PAZAR
10756	family	Homeodomain
10756	type	ChiP-seq
10756	class	Helix-Turn-Helix
10756	description	homeobox A9
10756	centrality_logp	-181.34
10756	tax_group	vertebrates
10756	alias	Hox-1.7,D6a9
10756	tfe_id	684
10756	symbol	HOXA9
10757	symbol	SREBF1
10757	medline	8156598
10757	source	ENCODE
10757	family	Helix-Loop-Helix
10757	type	ChiP-seq
10757	class	Zipper-Type
10757	description	sterol regulatory element binding transcription factor 1
10757	centrality_logp	-58.13
10757	tax_group	vertebrates
10757	alias	SREBP1,bHLHd1,SREBP-1c
10757	tfe_id	845
10758	tax_group	vertebrates
10758	alias	SREBP2,bHLHd2
10758	tfe_id	846
10758	symbol	SREBF2
10758	medline	8156598
10758	source	ENCODE
10758	family	Helix-Loop-Helix
10758	type	ChiP-seq
10758	class	Zipper-Type
10758	description	sterol regulatory element binding transcription factor 2
10758	centrality_logp	-50.53
10759	type	ChiP-seq
10759	class	Zinc-coordinating
10759	description	THAP domain containing, apoptosis associated protein 1
10759	centrality_logp	-57.58
10759	tax_group	vertebrates
10759	alias	DYT6,FLJ10477,4833431A01Rik
10759	symbol	THAP1
10759	medline	15863623
10759	source	ENCODE
10759	family	THAP
10759	comment	The profile has been trimmed to keep the core DNA-binding of the TF since the right part of the motif is bound by something we do not know.
10760	source	PAZAR
10760	family	ETS
10760	type	ChiP-seq
10760	class	Winged Helix-Turn-Helix
10760	description	ets homologous factor
10760	centrality_logp	-64.09
10760	tax_group	vertebrates
10760	alias	ESE3,ESEJ
10760	tfe_id	627
10760	symbol	EHF
10760	medline	20378718
10761	medline	15740636
10761	source	PAZAR
10761	family	BetaBetaAlpha-zinc Finger
10761	type	ChiP-seq
10761	class	Zinc-coordinating
10761	description	Kruppel-like factor 5 (intestinal)
10761	centrality_logp	-1688.59
10761	tax_group	vertebrates
10761	alias	BTEB2,IKLF,CKLF
10761	tfe_id	597
10761	symbol	KLF5
10762	tfe_id	820
10762	symbol	RFX2
10762	medline	8754849
10762	source	PAZAR
10762	family	RFX
10762	type	ChiP-seq
10762	class	Winged Helix-Turn-Helix
10762	description	regulatory factor X, 2 (influences HLA class II expression) 
10762	centrality_logp	-1688.91
10762	tax_group	vertebrates
10762	alias	FLJ14226
10763	description	nuclear receptor subfamily 3,group C,member 1 (glucocorticoid receptor)
10763	centrality_logp	-108.34
10763	tax_group	vertebrates
10763	alias	GR
10763	tfe_id	375, 325
10763	symbol	NR3C1
10763	medline	15563547
10763	pazar_tf_id	TF0000126
10763	source	PAZAR
10763	family	Hormone-nuclear Receptor
10763	type	ChIP-seq
10763	class	Zinc-coordinating
10758	tfbs_shape_id	370
10759	tfbs_shape_id	371
10760	tfbs_shape_id	372
10761	tfbs_shape_id	373
10762	tfbs_shape_id	374
10763	tfbs_shape_id	109